ID: 1067332958

View in Genome Browser
Species Human (GRCh38)
Location 10:45338834-45338856
Sequence AGACCTCCAGCCTTTTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067332952_1067332958 21 Left 1067332952 10:45338790-45338812 CCAACAATTTATGCTGTTAATCT 0: 22
1: 41
2: 89
3: 125
4: 370
Right 1067332958 10:45338834-45338856 AGACCTCCAGCCTTTTATCAAGG No data
1067332955_1067332958 -7 Left 1067332955 10:45338818-45338840 CCATTTTTTCCCAAGGAGACCTC No data
Right 1067332958 10:45338834-45338856 AGACCTCCAGCCTTTTATCAAGG No data
1067332954_1067332958 -6 Left 1067332954 10:45338817-45338839 CCCATTTTTTCCCAAGGAGACCT No data
Right 1067332958 10:45338834-45338856 AGACCTCCAGCCTTTTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067332958 Original CRISPR AGACCTCCAGCCTTTTATCA AGG Intergenic
No off target data available for this crispr