ID: 1067332963

View in Genome Browser
Species Human (GRCh38)
Location 10:45338849-45338871
Sequence TATCAAGGTAACTGTGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067332956_1067332963 -1 Left 1067332956 10:45338827-45338849 CCCAAGGAGACCTCCAGCCTTTT 0: 40
1: 69
2: 120
3: 136
4: 273
Right 1067332963 10:45338849-45338871 TATCAAGGTAACTGTGCATTGGG No data
1067332957_1067332963 -2 Left 1067332957 10:45338828-45338850 CCAAGGAGACCTCCAGCCTTTTA 0: 45
1: 69
2: 113
3: 129
4: 263
Right 1067332963 10:45338849-45338871 TATCAAGGTAACTGTGCATTGGG No data
1067332955_1067332963 8 Left 1067332955 10:45338818-45338840 CCATTTTTTCCCAAGGAGACCTC No data
Right 1067332963 10:45338849-45338871 TATCAAGGTAACTGTGCATTGGG No data
1067332954_1067332963 9 Left 1067332954 10:45338817-45338839 CCCATTTTTTCCCAAGGAGACCT No data
Right 1067332963 10:45338849-45338871 TATCAAGGTAACTGTGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067332963 Original CRISPR TATCAAGGTAACTGTGCATT GGG Intergenic
No off target data available for this crispr