ID: 1067332965

View in Genome Browser
Species Human (GRCh38)
Location 10:45338855-45338877
Sequence GGTAACTGTGCATTGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 38, 1: 156, 2: 147, 3: 111, 4: 270}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067332957_1067332965 4 Left 1067332957 10:45338828-45338850 CCAAGGAGACCTCCAGCCTTTTA 0: 45
1: 69
2: 113
3: 129
4: 263
Right 1067332965 10:45338855-45338877 GGTAACTGTGCATTGGGGAAAGG 0: 38
1: 156
2: 147
3: 111
4: 270
1067332955_1067332965 14 Left 1067332955 10:45338818-45338840 CCATTTTTTCCCAAGGAGACCTC No data
Right 1067332965 10:45338855-45338877 GGTAACTGTGCATTGGGGAAAGG 0: 38
1: 156
2: 147
3: 111
4: 270
1067332959_1067332965 -5 Left 1067332959 10:45338837-45338859 CCTCCAGCCTTTTATCAAGGTAA No data
Right 1067332965 10:45338855-45338877 GGTAACTGTGCATTGGGGAAAGG 0: 38
1: 156
2: 147
3: 111
4: 270
1067332954_1067332965 15 Left 1067332954 10:45338817-45338839 CCCATTTTTTCCCAAGGAGACCT No data
Right 1067332965 10:45338855-45338877 GGTAACTGTGCATTGGGGAAAGG 0: 38
1: 156
2: 147
3: 111
4: 270
1067332956_1067332965 5 Left 1067332956 10:45338827-45338849 CCCAAGGAGACCTCCAGCCTTTT 0: 40
1: 69
2: 120
3: 136
4: 273
Right 1067332965 10:45338855-45338877 GGTAACTGTGCATTGGGGAAAGG 0: 38
1: 156
2: 147
3: 111
4: 270
1067332960_1067332965 -8 Left 1067332960 10:45338840-45338862 CCAGCCTTTTATCAAGGTAACTG No data
Right 1067332965 10:45338855-45338877 GGTAACTGTGCATTGGGGAAAGG 0: 38
1: 156
2: 147
3: 111
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067332965 Original CRISPR GGTAACTGTGCATTGGGGAA AGG Intergenic
900809729 1:4792934-4792956 GGAAACCGTGCCCTGGGGAAAGG + Intergenic
901904245 1:12394035-12394057 GGTAACTGTGCACTGGGGAAAGG - Intronic
904179724 1:28657660-28657682 GTTAATTGTGCATTAGGGAAAGG - Intergenic
904325327 1:29724284-29724306 GGGAGCTCTGCATTGGGGTATGG - Intergenic
904335738 1:29796624-29796646 GGTAACTGTGCATTGGGCAAAGG + Intergenic
904357872 1:29952970-29952992 GGTGACTGTACGCTGGGGAAAGG + Intergenic
905091337 1:35433588-35433610 GTTATCTGGGTATTGGGGAATGG - Exonic
905258154 1:36698794-36698816 CGTAACTGTGGCTTGGGGAGGGG - Intergenic
905465031 1:38146742-38146764 GGTAACTGTGCACTGGGGAAAGG + Intergenic
906018439 1:42604688-42604710 GGGGACTGGGCATTGGAGAAAGG - Intronic
907597159 1:55730725-55730747 TGTAATTGTGCATAGGGGAAAGG + Intergenic
907695961 1:56729299-56729321 TGTGGCTGTGCATTGGGGATGGG + Intronic
908737374 1:67290722-67290744 GGTAACTGTGCACTGGGGAAAGG + Intergenic
909474483 1:76066904-76066926 GGGAACTGGGGCTTGGGGAATGG + Intergenic
909549139 1:76878526-76878548 GGTACCTGTGCACTGGGGAAAGG - Intronic
909576725 1:77184496-77184518 AGTAACTGTGCACTGCGGAAAGG + Intronic
909633675 1:77792421-77792443 GGTAAGTGTGCATGGTGCAAGGG + Intronic
909781112 1:79548855-79548877 AGTAACTGTGCATGGAGGAAAGG + Intergenic
910561731 1:88598634-88598656 GGTAACTGTGCATTGGGGAAAGG + Intergenic
910588030 1:88900376-88900398 GGTAATTGTGCACTGGGGAAAGG + Intergenic
910831283 1:91464763-91464785 GGCAACTGTGCACTGGGGAGAGG - Intergenic
911113600 1:94219025-94219047 GGAAACTCTTCTTTGGGGAAAGG - Intronic
911736037 1:101337590-101337612 GGTAACTGTGTGTTGGGAAAAGG + Intergenic
911883384 1:103269104-103269126 GTTAACTATGCAATGGGGAAAGG + Intergenic
912050850 1:105526305-105526327 GGTAACTGTGCACTGGGGAAAGG - Intergenic
912066855 1:105755583-105755605 GGTAACTGGGAATTGGAGAAAGG + Intergenic
912130092 1:106589410-106589432 GGTAGCTGTGCATTGGGAAAAGG - Intergenic
912689086 1:111790463-111790485 GGCAAGTGGGCATTGGGGCATGG - Intronic
912733507 1:112130185-112130207 GCTAACTGTGCATTGGGGAAAGG - Intergenic
913039759 1:115010885-115010907 AGTAATTGTGCATTAAGGAAAGG + Intergenic
913588465 1:120299649-120299671 GGTGGCTGTGCATTTGGGTATGG - Intergenic
913619720 1:120598720-120598742 GGTGGCTGTGCATTTGGGTATGG + Intergenic
914570482 1:148911521-148911543 GGTGGCTGTGCATTTGGGTATGG - Intronic
914602348 1:149218748-149218770 GGTGGCTGTGCATTTGGGTATGG + Intergenic
915667850 1:157461011-157461033 GGTAACTGTGCGTTGGGTAAAGG - Intergenic
916285133 1:163098148-163098170 GGTAACTGTGCAGTGGGGAAAGG + Intergenic
916920524 1:169461328-169461350 GGGAACTGTGTAGTGGAGAAAGG - Intergenic
917052649 1:170941204-170941226 GGTAAGTGTGCCTTGGGGAAAGG - Intronic
917217402 1:172692271-172692293 GGTAACTGTGCATTGGGGAAAGG - Intergenic
917225716 1:172779762-172779784 CGTATGTGTGCGTTGGGGAAGGG + Intergenic
917237364 1:172908753-172908775 GGAAACTATGCATTGGACAAAGG + Intergenic
917764521 1:178202013-178202035 AGTAACTGTGCATTGGAGAAAGG + Intronic
918774321 1:188609398-188609420 AGTAACTGTGCATTGGGGAAGGG + Intergenic
918958083 1:191236670-191236692 GGTAACTGTACACTGGGGAAAGG + Intergenic
919230201 1:194763913-194763935 GGTAACTGTGCACTAGGGGAAGG - Intergenic
919241619 1:194923138-194923160 GGTAACTGTGCACTGGGGAAGGG + Intergenic
919554035 1:199029343-199029365 GGTAATTGTTCACTGGGGAAAGG - Intergenic
919983835 1:202659186-202659208 GTTTGCTGTGCATTGGGAAAGGG - Intronic
920197238 1:204237004-204237026 GGTGACTGTGCATTGGGGAAAGG + Intronic
920244454 1:204577230-204577252 GGTAACTATGCAGAGAGGAAAGG + Intergenic
921364604 1:214361851-214361873 GGTAGCTGTGCAGTGGGGAGTGG - Intronic
921559561 1:216640667-216640689 GGTAACTGAGCATTTAGGAATGG + Intronic
921710329 1:218367127-218367149 GGCAACGGTGGAGTGGGGAAGGG + Intronic
924840954 1:247709166-247709188 GGTAACTGTACATTGGGGAAAGG - Intergenic
924847327 1:247786591-247786613 GGTAACTGTGCACTGGGGAAAGG - Intergenic
1063639224 10:7814208-7814230 GGTAACGGTCCACTGGGGAAAGG + Intergenic
1063675065 10:8133638-8133660 GGAAACTGTGTACTCGGGAAGGG + Intergenic
1065344072 10:24732195-24732217 AGTCACTGTGAATCGGGGAAGGG - Intergenic
1065969656 10:30796265-30796287 GGTAACCATGCACTGGGGAAAGG + Intergenic
1066167225 10:32800608-32800630 GGTAACTGTGCATAGGGGAAAGG - Intronic
1066543544 10:36475108-36475130 GGTAACTGTGCATTGGGGAAAGG + Intergenic
1067332965 10:45338855-45338877 GGTAACTGTGCATTGGGGAAAGG + Intergenic
1067754531 10:48995085-48995107 GGTAACTGTGCACTGGGGAAAGG - Intergenic
1067824490 10:49560222-49560244 GGTAACAGTACAGTGTGGAAGGG - Intergenic
1067837975 10:49653223-49653245 GGTAGCTGTGTGTCGGGGAAGGG + Intronic
1068225529 10:54102964-54102986 GGTCACTGTGCACTGGGGAAAGG - Intronic
1068447015 10:57137234-57137256 TGTAACTGTACATTGGGGAAAGG + Intergenic
1068837437 10:61569965-61569987 GGTAACTGTGCACTGGAGAATGG - Intergenic
1069145558 10:64888806-64888828 GGTAACTGTGTATTGGGGAAAGG + Intergenic
1069657269 10:70099220-70099242 GGTCACTGTCCACTGGGGGAGGG - Intronic
1069791019 10:71020941-71020963 GGTAACTGTGCATTGGGGAAAGG - Intergenic
1070053083 10:72907903-72907925 GGTAAATGTGCCTTAGAGAAGGG - Intronic
1070712990 10:78696947-78696969 GGGAAGTGTGCTATGGGGAAGGG - Intergenic
1071267269 10:83975359-83975381 GGTAACTGTGCATTGGGGAAAGG - Intergenic
1071378206 10:85032071-85032093 AGTAATTGAGCAATGGGGAAAGG + Intergenic
1071511023 10:86262628-86262650 GTTAACAGTGAAGTGGGGAAGGG - Intronic
1071937513 10:90547962-90547984 GGTAGCTGTGCATTGGAGAAAGG + Intergenic
1071942974 10:90609139-90609161 GGTAACTGTGCACTGGGGAAAGG - Intergenic
1072209453 10:93233046-93233068 GGTAACTGTGCATTGGGAAAAGG - Intergenic
1072360285 10:94652789-94652811 AGTAACTGTCCACTGGGGAAAGG + Intergenic
1073557157 10:104464546-104464568 GGTAACTGTGCACTGGGGAAAGG + Intergenic
1073622612 10:105064675-105064697 GGTATCTCAGCTTTGGGGAAGGG + Intronic
1073656832 10:105425598-105425620 GGTAACTGTACATTGGAGAAAGG - Intergenic
1073854914 10:107662857-107662879 GGTAACTGTGCACTGGGGAAAGG + Intergenic
1073957850 10:108892999-108893021 GGTAACAGCTCACTGGGGAAAGG - Intergenic
1074317856 10:112375542-112375564 GGTATCTGTGAGGTGGGGAAGGG + Intronic
1076123030 10:127951380-127951402 GGTAACTGTGTGCTGGGGAGAGG + Intronic
1076516344 10:131046844-131046866 GGCTGCTGTGCATTGGGAAAGGG - Intergenic
1076927600 10:133500588-133500610 GATAACTGTGCGCTGGGGAAAGG - Intergenic
1077399123 11:2344614-2344636 AGTAACTGTGCACTAGGAAAAGG + Intergenic
1080432923 11:32215250-32215272 GCTGACTGTGCAGAGGGGAACGG - Intergenic
1081065643 11:38536260-38536282 GATAACTGTGCATTAGGGAAAGG - Intergenic
1081072607 11:38629738-38629760 GGTAACTGTGCACTGGGAAAAGG + Intergenic
1081110288 11:39127033-39127055 GGTAACTGTGCACTGGGGAAAGG + Intergenic
1081447677 11:43146103-43146125 GGTTATTCTGGATTGGGGAAGGG + Intergenic
1081608865 11:44546489-44546511 GGTAACTGTGCACTGGGGAAAGG + Intergenic
1082671520 11:56041678-56041700 GGTAACTGTGCATTGGGGAAAGG + Intergenic
1084742672 11:71149797-71149819 GCTAACTGTGCATAGGTGAGAGG + Intronic
1085684365 11:78608384-78608406 AGTAACTCCGCATTGGGGAAGGG + Intergenic
1085685771 11:78620808-78620830 GGTAACTGTGCACTGGGGAAAGG + Intergenic
1085747389 11:79126867-79126889 AGTAATTGTGCACTGGAGAAAGG + Intronic
1086259186 11:84916994-84917016 TGGAAGTGTGCATTGGGGGATGG - Intronic
1086278442 11:85159088-85159110 GGTATCTGTGCACTGGGGAAAGG + Intronic
1086368866 11:86136170-86136192 GTTAACTGTGCAGCAGGGAATGG - Intergenic
1086833936 11:91599012-91599034 GGTAACTGTGCACTGGGGAAAGG + Intergenic
1087410930 11:97789526-97789548 GGTAGCTGTGCATTGGGGAAAGG - Intergenic
1088449167 11:109963973-109963995 AGTAATTGTGTACTGGGGAAAGG + Intergenic
1088813866 11:113408756-113408778 GGTATGTGTGCAATGGGGATGGG + Intergenic
1089903431 11:122012235-122012257 GGTAATTGTGCACTGGGGAAAGG + Intergenic
1090221794 11:125032958-125032980 GGTAACTGTGCACTGGGAAAAGG - Intronic
1090707133 11:129348466-129348488 GGCAACTGTGAATTAGGGGAAGG + Intergenic
1091051552 11:132377364-132377386 GGTAACTGTGCATTGGGGAAAGG + Intergenic
1092093098 12:5820273-5820295 GGTAACTGTGCATTGGGGAAAGG + Intronic
1092381198 12:7998472-7998494 GGTAATTGTGCATTGGGGAAAGG + Intergenic
1092465836 12:8730659-8730681 GACAACTTTGCATTGTGGAAAGG + Intronic
1092852331 12:12640945-12640967 CATAACTGTGCATTTGGCAATGG - Intronic
1092922723 12:13246768-13246790 GGTAACTGTGCACTTGGGAAAGG - Intergenic
1092971995 12:13704999-13705021 GGTACCTGGGAATTGGAGAAGGG - Intronic
1093032044 12:14297333-14297355 GGTAACTGTGCATTGGGGAAAGG - Intergenic
1093036114 12:14333961-14333983 GGTAACTGCGCATTGAAAAAGGG + Intergenic
1093049106 12:14486334-14486356 GGTAACTGTGCACTGGGGAAAGG - Intronic
1093843415 12:23935139-23935161 GGTAACGAGGCATTGGGGAATGG - Intronic
1094102346 12:26777876-26777898 GGTAACTGTGCACTGGAGAAAGG + Intronic
1094765562 12:33590408-33590430 TGTTTCTGTGCTTTGGGGAAAGG - Intergenic
1095179661 12:39132731-39132753 GGTAACTGTGTCTTGGGAATAGG + Intergenic
1095856409 12:46865051-46865073 GGTAACTGTGTATTGGGGAAAGG - Intergenic
1096138561 12:49223461-49223483 GGAAACTGTGTATTTGGTAATGG - Intronic
1097158372 12:57028748-57028770 GGTGACTGTGCAGTGAGGAGGGG - Exonic
1097821574 12:64133552-64133574 GGTAACTGTGTAATGGGGAAAGG - Intronic
1097843546 12:64344140-64344162 GGTAACTGTGCATTTGGGAAAGG - Intronic
1098672861 12:73252866-73252888 GGTAACTATGCAGTGGGAAAAGG + Intergenic
1098715910 12:73828423-73828445 GGTAACTGTACATTGGGCAAAGG + Intergenic
1098730875 12:74035974-74035996 GGTAACTGTGCATTGGGGAAAGG + Intergenic
1098733126 12:74064266-74064288 GGTAGCTGTCCATCGAGGAAAGG + Intergenic
1098749659 12:74278117-74278139 GGTAACTGTGCTATGGAGAAAGG + Intergenic
1098805264 12:75014701-75014723 GGTAAATGTTCATTGGTGAAAGG + Intergenic
1098832092 12:75375410-75375432 GGTAACTATGCACTGGGGAAAGG - Intronic
1099183979 12:79498051-79498073 GGTAAGTGTACATTGGGAAAGGG - Intergenic
1099205294 12:79719933-79719955 GGTATCTGGACATTGTGGAATGG - Intergenic
1099365757 12:81764077-81764099 AGTAACTGTGCAATGGGGAAAGG + Intergenic
1099375464 12:81892589-81892611 GGTAACAGTGCACTGGGGAAAGG + Intergenic
1099379856 12:81940194-81940216 GGTAACTGTCCACTGGGGAAAGG - Intergenic
1099400274 12:82194874-82194896 GGTAACTGTGCACTGGGGAAAGG + Intergenic
1099401298 12:82206082-82206104 GGAAACTGTGCATTGGGAAAGGG - Intergenic
1099526205 12:83721746-83721768 GGTGACCTTGCATTGGAGAAAGG + Intergenic
1099577917 12:84404073-84404095 GGCAACTGTGCACTGGGGAAAGG + Intergenic
1099735604 12:86563662-86563684 GGTAACTGTGCTTTGGGGATAGG + Intronic
1099859575 12:88209999-88210021 GGTAAATATGCACTGGGGAAAGG - Intergenic
1100083134 12:90876855-90876877 GATAACTGTGCACTAGGGAAAGG + Intergenic
1100147538 12:91696587-91696609 ACTAACTGTGCACCGGGGAAAGG + Intergenic
1100241337 12:92712992-92713014 GGTAACTGTGTACTGGGGAAAGG - Intergenic
1100896207 12:99185677-99185699 AGGAACTGTGCAGTGAGGAACGG + Intronic
1101044058 12:100786448-100786470 GGTACCTCTGCATTGGGGCAGGG + Intronic
1101534861 12:105607480-105607502 GGTAACTGGGCACTGGGGAAAGG - Intergenic
1103035423 12:117652670-117652692 GGTAACTGTGCACTGGGGAAAGG + Intronic
1103396334 12:120610064-120610086 GGTAACTGTGCACTGGGGAAAGG + Intergenic
1103862307 12:124024997-124025019 GGTATCTGGGCCTTAGGGAATGG + Intronic
1104637146 12:130445008-130445030 GGTAACTACGGAGTGGGGAAGGG + Intronic
1108396088 13:49993302-49993324 AGCAACTGTGCATAGGGGAAGGG - Intergenic
1108843420 13:54649887-54649909 TGTTACTGTGCACTGGGGAAAGG - Intergenic
1108914482 13:55590275-55590297 AGTAACTGTGCACTGGGGAAAGG - Intergenic
1109331770 13:60939802-60939824 GGGGATCGTGCATTGGGGAATGG + Intergenic
1109421369 13:62116301-62116323 GGTAACCTTGCATGGGGTAAGGG - Intergenic
1109516092 13:63443927-63443949 GGTAACTGTGCACTGGAGAAAGG + Intergenic
1109582874 13:64364764-64364786 GACAACTGTGCATTGCAGAAAGG + Intergenic
1109712857 13:66182278-66182300 GGTAACTGTGCATTGGGGAAAGG - Intergenic
1109905528 13:68835350-68835372 GGTAGCTGTGCATTTGGGATAGG - Intergenic
1109943899 13:69406854-69406876 GGTAACCGTGCACTGGGGAAAGG - Intergenic
1109951208 13:69503599-69503621 GGTAACTGTGCATTGGTGAAAGG - Intergenic
1110376996 13:74805105-74805127 AGTAACTGTGCACTGGGGATAGG + Intergenic
1111057967 13:82974339-82974361 GGTAACTGTGCACTGCGGAAAGG - Intergenic
1111402006 13:87750002-87750024 AGTTACTGTGTATTTGGGAAAGG + Intergenic
1111432396 13:88160990-88161012 GGTAACTGTGCATTGAAAAAAGG - Intergenic
1111575934 13:90154150-90154172 GGTAACTGTGCATTGGAGAAAGG - Intergenic
1112250113 13:97771616-97771638 GGTAACTGTGCACTGGGGAAAGG - Intergenic
1113211830 13:107992734-107992756 GCTTACTGTGCTGTGGGGAAGGG + Intergenic
1113319895 13:109223049-109223071 GGTAACTGTGGATTAGGGAAAGG - Intergenic
1113396012 13:109948472-109948494 GGTAACTGTGCATTGGGAAAAGG + Intergenic
1114205689 14:20569396-20569418 GGTAACTGTACACTGGGAAAGGG + Intergenic
1114359033 14:21949686-21949708 GTTATCTGTGCATGGGGGAATGG + Intergenic
1114396832 14:22371428-22371450 GGTCATAGTGCATTTGGGAAGGG - Intergenic
1114758446 14:25285247-25285269 GGTAACTGAGCACTGGGGAAGGG - Intergenic
1114905564 14:27121838-27121860 GGTAACTGTGCACTGGAGAAAGG - Intergenic
1114929861 14:27453175-27453197 GTTAACTGTACAGTGGAGAAGGG - Intergenic
1115059524 14:29172520-29172542 AGTAAGTGTGCATTGGGGAAAGG + Intergenic
1116058721 14:39895554-39895576 AGTAACTGTGCATTGGAGAAAGG + Intergenic
1116067900 14:40007794-40007816 GGTAACTGTGTATTGGAGAAAGG + Intergenic
1116175899 14:41469894-41469916 GGTGACTGTGCACTGCAGAAAGG - Intergenic
1116531627 14:45979584-45979606 GGTAACTGTGCATTTGGAAAAGG - Intergenic
1116791489 14:49344763-49344785 GGTAACCATACATTGGAGAAAGG + Intergenic
1117001397 14:51374911-51374933 AGTGTCTGTGCACTGGGGAAAGG + Intergenic
1117216642 14:53558718-53558740 GGTAACTGTGCAATGGGGAAAGG + Intergenic
1117596459 14:57331264-57331286 AGTAACTGTGCACTGGGGAAAGG - Intergenic
1118880951 14:69825389-69825411 GGTAACTGTGCATTGGAGAAAGG - Intergenic
1118950745 14:70434452-70434474 GGTAACTGTGCACTGGGGAAAGG - Intergenic
1119059880 14:71463524-71463546 GGTAACTGTGCACTGGGGAAAGG - Intronic
1120082213 14:80228918-80228940 GGTAGCTGTGCATTGGAGAAAGG - Intronic
1120231603 14:81846638-81846660 GGTAACTGTGCACTGGGGAAAGG - Intergenic
1120556178 14:85931816-85931838 GGTAATTGTGCATTGGGGAAAGG - Intergenic
1120973479 14:90229082-90229104 GGTAACTGTGCATTAGGGAAAGG + Intergenic
1121371194 14:93359911-93359933 GGTAACTGTGCACTGGGGAAAGG + Intronic
1122057791 14:99116635-99116657 GGTGTCTGTGTGTTGGGGAATGG - Intergenic
1125205726 15:37151763-37151785 GGTAACTGTTTACTGGGGAAGGG + Intergenic
1125783411 15:42292030-42292052 GGACACTGTGCACTGGAGAAAGG + Intronic
1126521067 15:49594326-49594348 GTAAACTGTGCATTGGACAAAGG - Intronic
1126716554 15:51524581-51524603 AGTTTCTGTGCACTGGGGAAAGG + Intronic
1126906070 15:53367192-53367214 GGTGACTGTGCATTGAGGAAAGG - Intergenic
1127356719 15:58207805-58207827 GGTAACTGTGCATTGGGGAAAGG + Intronic
1127688006 15:61367431-61367453 GGTGATTGTGAATTGGGGAAGGG + Intergenic
1128092764 15:64930325-64930347 GTGATCTGTGCAGTGGGGAAAGG + Intronic
1128642621 15:69350882-69350904 GGTAACTGTGCTTTAGGAAAAGG + Intronic
1129961522 15:79691121-79691143 GGTAACTGTGCACTGGGGAAAGG - Intergenic
1131305030 15:91234826-91234848 GGTGACTGTGCATTGGGGAAAGG + Intronic
1131935409 15:97498892-97498914 GGTAACTATGCTTTGGGAAAGGG - Intergenic
1134584810 16:15400692-15400714 GGTTACTTTGCATTTTGGAATGG + Intronic
1135061854 16:19277856-19277878 GGTAACTGTGCACTGGGGAAAGG - Intergenic
1136191718 16:28620207-28620229 GGTTACTTTGCATTTTGGAATGG - Intronic
1136529521 16:30858380-30858402 GGTGTCTGTGCCTTGGGGAGAGG + Intronic
1137324294 16:47418279-47418301 GGAAACTGTTCATTAGGCAAGGG - Intronic
1137988382 16:53130069-53130091 CGTAACTGTGCAATGGAGAACGG + Intronic
1138576714 16:57912071-57912093 GCTGACTGTGCACTGGGGGATGG + Intronic
1138868207 16:60849406-60849428 GTTAACTGTGCATTGGGGAAAGG + Intergenic
1138934750 16:61705472-61705494 GATCACTGTGCATTTGGAAAGGG + Intronic
1139793109 16:69456771-69456793 GGGAACTGTGCCTAGGGGAAGGG + Intronic
1140194919 16:72847954-72847976 GAGAACTGTGTTTTGGGGAAGGG + Intronic
1140394299 16:74613907-74613929 GGTGACTGTACATTGGCAAAAGG - Intergenic
1140597600 16:76435014-76435036 GGTAACTGTGCACTGGGGAAAGG - Intronic
1141189908 16:81816964-81816986 GGTAACTGTGCAATGGGCATAGG - Intronic
1141559731 16:84859413-84859435 GGAAACCGTGCACTGGGGAAAGG - Intronic
1142945790 17:3425999-3426021 GGTAACTGTGCATTGGGGAAAGG - Intergenic
1144306456 17:13973191-13973213 GGAAAATGGGCATTGGGCAAAGG + Intergenic
1144872045 17:18377748-18377770 GGCGGCTGGGCATTGGGGAAGGG - Exonic
1145116736 17:20217399-20217421 GGTAACTCGGCATGGGGGAGGGG - Intronic
1149236185 17:54593628-54593650 GATAACTGTGCACTGGGAAGAGG - Intergenic
1149817752 17:59743017-59743039 GGAAACTGTGTGGTGGGGAAAGG - Intronic
1149982836 17:61325058-61325080 GCTAACTGTGCATGGTGGGATGG - Intronic
1150007515 17:61479000-61479022 GGTCTCTGTGTTTTGGGGAATGG + Intronic
1152676219 17:81642614-81642636 GAGAACTGCGCAGTGGGGAAGGG - Intronic
1153078494 18:1193307-1193329 ATTAACTGTGCTTTGGGGGAGGG - Intergenic
1153131462 18:1859103-1859125 GGTAACTGTGCACTGGGGAAAGG - Intergenic
1153217886 18:2836993-2837015 TGTGACTGTGCATTGCAGAAAGG - Intergenic
1153955781 18:10094923-10094945 GGTAACTGTGCATTGAGGAAAGG + Intergenic
1154068281 18:11129713-11129735 GGTAACTGTGCATTGAGGAAAGG + Intronic
1154252919 18:12758983-12759005 GGTAACTGTGCATTGGGGAAAGG - Intergenic
1154506003 18:15041482-15041504 GGTAACTGTGCATTGATGAAAGG + Intergenic
1155110701 18:22711284-22711306 TGTAACTGTGACTTGGGAAAGGG - Intergenic
1155488366 18:26371919-26371941 AGTGATTGTGCACTGGGGAAGGG + Intronic
1155741943 18:29299376-29299398 GGTAACTGTGCATTGGGGAAAGG - Intergenic
1156192232 18:34733090-34733112 GGTAACTGTGCACTGGGGAAAGG - Intronic
1156291616 18:35752870-35752892 GCACACTGGGCATTGGGGAAGGG + Intergenic
1156442102 18:37200883-37200905 GGGAACTGTGGGTTGGGGGAGGG - Intronic
1156537604 18:37879146-37879168 GGTAACTGTGCACTGGGGAAAGG + Intergenic
1156990472 18:43402078-43402100 GATAACTGTGCACTGGGGAGAGG - Intergenic
1156998415 18:43496336-43496358 GATAACTATGCACTGGGGAAAGG + Intergenic
1157780952 18:50438707-50438729 GGTGACTGGGGATAGGGGAAGGG - Intergenic
1157871159 18:51231302-51231324 GGTAACTGTGCATGGAGGAAAGG - Intergenic
1159276985 18:66234106-66234128 GGTAACTGTGCAGTGGGGAAGGG + Intergenic
1159287608 18:66374091-66374113 GGTAACTGTGCACTTGGGAAAGG + Intergenic
1162631422 19:11930060-11930082 GGTATCTGTGCCTAGGGGAGTGG + Intronic
1164097304 19:22023054-22023076 GGTTATTGTGCACTGGGGAAAGG - Intergenic
1164117496 19:22236490-22236512 GGTAACTGTGCATTGGGGAAAGG - Intergenic
1164200195 19:23011769-23011791 GGTAACAGTGCACTGGGAAAAGG - Intergenic
1165403804 19:35618150-35618172 GGTCCCTGTGCAGTGGGGATGGG + Exonic
1165810397 19:38608301-38608323 GGGAACTGTCCCTTGGGGAAAGG + Intronic
1167393983 19:49215299-49215321 AGTAACTGTGTATTGGGGAAAGG + Intergenic
1168179802 19:54654026-54654048 GGTAGCTGTGTACTGGGTAAAGG - Intronic
1168539542 19:57198752-57198774 GGTAACTGTGCACTGGGGAAAGG - Intronic
925460539 2:4059084-4059106 GGTAACTGTACACTGGGGAAGGG + Intergenic
925499585 2:4488292-4488314 GGTAACTGTGCATTGGGGAAAGG - Intergenic
926698331 2:15785854-15785876 GGTACGTGTGCTTTGGGGATGGG - Intergenic
926810575 2:16752056-16752078 GGTAACCGTGCAATGGGTAAAGG - Intergenic
926826594 2:16912306-16912328 GGTAACTGTGCACTGGGGAAAGG + Intergenic
929270016 2:39962154-39962176 GGTAACTGTGCACTGGGGAAAGG - Intergenic
929284861 2:40124303-40124325 GGTAGATATCCATTGGGGAAAGG - Intronic
929530047 2:42744539-42744561 GGTCACTGAGAATGGGGGAAAGG - Intronic
930067186 2:47336627-47336649 GTTAACTGTGGATTGGGACAAGG - Intergenic
930215301 2:48690117-48690139 AGTAACTTTGTATTTGGGAAAGG - Intronic
930456443 2:51613147-51613169 GGTAACTGTGTATTGGAAAAAGG - Intergenic
930536784 2:52653637-52653659 ATTAACTGTGCATTAGGGATAGG - Intergenic
932975605 2:76596631-76596653 GGTAACTGCGCATTGAGGAAAGG + Intergenic
933265904 2:80180101-80180123 GGTAACTGTGCACTGGGGAAAGG - Intronic
933280689 2:80329771-80329793 AGTGACTGTCCATAGGGGAATGG + Intronic
933306708 2:80609458-80609480 GGTGACTGTGCTTTGGGAAGAGG - Intronic
933309710 2:80645233-80645255 GAGAACTGTGCATTGGCCAAAGG + Intronic
935564501 2:104591646-104591668 GGTATCTGTGCACTGGGGAAAGG - Intergenic
936109435 2:109652892-109652914 GTTGACTGTGCATCTGGGAAAGG - Intergenic
937785380 2:125889096-125889118 GGCAACTGTGCACTGGGGAAAGG - Intergenic
937800149 2:126073361-126073383 GGAAACTGTGAATTGGGGAAAGG + Intergenic
937852749 2:126650108-126650130 GGTAACTGTGCACTGGGGAAAGG - Intergenic
939029003 2:137047797-137047819 GATAAATGTGCATAGGGCAAAGG + Intronic
939213640 2:139210535-139210557 GGTAACTGTACACTGGGGAAAGG + Intergenic
939687214 2:145214020-145214042 AGTGACTGTGCCTTGAGGAATGG - Intergenic
939788857 2:146547460-146547482 GGTAACTGTGCACTGGGGAAAGG - Intergenic
939806064 2:146777099-146777121 GGTAAGTGTGCTTTGGGGAAAGG + Intergenic
939868093 2:147497490-147497512 GGGAAATGAGCATTGGGGATGGG - Intergenic
940171502 2:150834104-150834126 GGTAGCTGTGCACTGGGGAAAGG - Intergenic
940606095 2:155925738-155925760 GGTAACTGTGCATTGGGAAAAGG - Intergenic
940903254 2:159146225-159146247 GGGCTCTGTGCATTAGGGAAGGG + Intronic
940903465 2:159147509-159147531 GGTAGCTGGGCGTTTGGGAAAGG - Intronic
940924575 2:159349925-159349947 AGTAACTGGTCATTGGGGAGAGG + Exonic
941667826 2:168259802-168259824 GGTAACTGTGCATTGCGGAAAGG + Intergenic
941777728 2:169410987-169411009 GGTAACAGTGCATTTGGTAAGGG - Intergenic
942020108 2:171859209-171859231 GGTAACTGAGTATTGAGGGATGG - Intronic
942222025 2:173779845-173779867 GGTAACTATGCACTGGAGAGAGG - Intergenic
942782174 2:179657081-179657103 GGTCACTCTGTATTGGGGCAGGG + Intronic
942948010 2:181690525-181690547 GGTAACTGTGTAGTGGGAGATGG + Intergenic
943239389 2:185363971-185363993 GGTAACTGTGTACTGAGGAAAGG - Intergenic
943318029 2:186413035-186413057 GTTAACTGTGCAATGGGGAAAGG - Intergenic
943320346 2:186436384-186436406 GTTGACTGTTCATAGGGGAACGG + Intergenic
943384210 2:187182252-187182274 GGTAACTGTGCATTGGAGACAGG - Intergenic
943387960 2:187225751-187225773 GGTAACTGTGCACTGGGGAAAGG + Intergenic
943452197 2:188057577-188057599 GTTAAGGGTGCTTTGGGGAAAGG + Intergenic
943464712 2:188215057-188215079 GGTATCTGTCCATGGGAGAATGG - Intergenic
943517781 2:188908618-188908640 GGTAACTGTGCAGTGGGGAAAGG - Intergenic
944738511 2:202589744-202589766 GCAAACTGTCCATAGGGGAAGGG - Intergenic
945641982 2:212442444-212442466 GGTAACTGTGCACAGGGGAAAGG + Intronic
945726011 2:213472864-213472886 GGTAACTGTGCATTGGAGGAAGG - Intronic
945940183 2:215941514-215941536 GATAACTGTACACTGGGGAAGGG - Intergenic
946114979 2:217453476-217453498 GGTTTCTGGGCATAGGGGAATGG + Intronic
946528049 2:220541356-220541378 GGTAACTGTGCATTGGGGAAAGG - Intergenic
946703970 2:222439168-222439190 GGTAACTGTGCACTGGGGAAAGG - Intronic
946790742 2:223298382-223298404 GGTAACTGTGCATTGGGAAAGGG + Intergenic
947563246 2:231176422-231176444 GGGTACTGAGCAGTGGGGAAGGG - Intergenic
948369393 2:237478406-237478428 GATAACTGTACATAGGGGAAAGG - Intergenic
1168993302 20:2113161-2113183 GGTGCCTGTGCATTGAGGAAGGG - Intronic
1169252515 20:4071501-4071523 GGCAGCTTTGCAGTGGGGAAAGG + Intronic
1169758468 20:9067773-9067795 GGCACCTGCGCATTGGGGACTGG - Intergenic
1172283982 20:33728107-33728129 GCTCACTGTGCAGGGGGGAATGG + Intergenic
1172327721 20:34049898-34049920 GGTGACTGTGAAAAGGGGAAGGG - Intronic
1173709313 20:45140625-45140647 GGGAACTGTGTACTGGGGAAAGG - Intergenic
1173765378 20:45603272-45603294 CAAAACTGTACATTGGGGAAAGG - Intergenic
1175400991 20:58699754-58699776 GGTTCCTGGGCAGTGGGGAAAGG - Intronic
1176791851 21:13327544-13327566 GGTAACTGTGCATTGATGAAAGG - Intergenic
1177002796 21:15634922-15634944 GGTAACTGTGCGCTGGGGAAAGG - Intergenic
1177363553 21:20104474-20104496 GGTAACTGTGCACTGGAGAAAGG + Intergenic
1177505797 21:22015901-22015923 GGTAACTGTGCAATGGGGAAAGG - Intergenic
1177933875 21:27318314-27318336 GATAACTGTGCACTGGGGAAAGG - Intergenic
1177991244 21:28038546-28038568 GGCAACTGTGCATTGATGAAAGG - Intergenic
1178444213 21:32623870-32623892 GGGGAGTGTGTATTGGGGAAGGG + Intergenic
1178764001 21:35432311-35432333 GTTAACTGTTCACTGGGAAAAGG - Intronic
1178864508 21:36316882-36316904 AGGAACTGTGCCTTGAGGAACGG - Intergenic
1179045439 21:37840380-37840402 TGTAACACTGCATTGGGGATTGG - Intronic
1179415345 21:41193905-41193927 GGTAACTGTGCACTGGGGAAAGG - Intronic
1180591323 22:16939749-16939771 GGTAACTGTGCATTGGGGAAAGG - Intergenic
1180873481 22:19161957-19161979 GGTAGCTGTGCGCTGGGGAAAGG - Intergenic
1180913040 22:19466532-19466554 GATAAGTCTGCATTGGGGCAGGG + Intronic
1181547236 22:23609013-23609035 GGTAAATGGGCCTTGGAGAATGG - Intronic
1182236778 22:28883012-28883034 GGGAACTGTGAATTGGGGCGGGG + Intergenic
949125851 3:444535-444557 GGTAACTGTGCATTGGGGAAAGG - Intergenic
949170224 3:987980-988002 GGTAACTGTGCATTGGGGAAAGG - Intergenic
949445428 3:4129666-4129688 GATAACTGTGCATTGGGAAAGGG + Intronic
949509477 3:4755652-4755674 GGTCACTGGGCTCTGGGGAACGG - Intronic
951423627 3:22517113-22517135 GTTAACTGTGCATTGGGGAAAGG + Intergenic
951978654 3:28542279-28542301 GGTAACTGTGCACTGGGGAGAGG + Intergenic
952730997 3:36636399-36636421 GGTAACAGTGCAGTGTGGAGAGG - Intergenic
953712392 3:45285568-45285590 GGTAACTGTGTTTTAGGGAAAGG - Intergenic
953897573 3:46813877-46813899 GGTAACTGTGCACTGGGGAAAGG - Intergenic
955623962 3:60896441-60896463 TACAACTGTGGATTGGGGAAAGG - Intronic
955630741 3:60971542-60971564 GCTATCTATGCATTGGAGAAAGG + Intronic
956260600 3:67336196-67336218 TGTAACAGTCCACTGGGGAAGGG - Intergenic
956509466 3:69978974-69978996 GGTAACTGTGCATTGGGGAAAGG + Intergenic
957247716 3:77734710-77734732 GGTAACTGTGTGTTGGGGAAAGG - Intergenic
957409505 3:79819896-79819918 GGTATATATGCATTGTGGAATGG + Intergenic
958137093 3:89508096-89508118 GATGACTATGCATTGGAGAAAGG - Intergenic
958789018 3:98629970-98629992 GGTAACTGTGCATTGGGAAAAGG - Intergenic
958845711 3:99261896-99261918 GGTAACTGTGTATTGGGGAAAGG - Intergenic
958934124 3:100239248-100239270 GGTAACTATGTATTGGGGAAAGG + Intergenic
959226954 3:103598655-103598677 GGTAACTGTGCATTGGGGAAAGG - Intergenic
959523113 3:107343076-107343098 GGTAAGTGTCCATGGGAGAAGGG + Intergenic
959578749 3:107962829-107962851 GGTAACAATGTACTGGGGAAAGG - Intergenic
959746191 3:109778631-109778653 GGTAACTGAACAATGGGGAAAGG - Intergenic
959828317 3:110829016-110829038 GGTAAATTAGCATTGGGAAAAGG - Intergenic
960494922 3:118362168-118362190 AGTAACTGTGTACTGGGGAAAGG - Intergenic
962208180 3:133452836-133452858 GGTAACTGTTTCTTTGGGAAAGG + Intronic
962299016 3:134220865-134220887 GGAAACTGTGTAATGGTGAAGGG + Intronic
963355847 3:144208224-144208246 GATAACTGTGCATTGAGGAAAGG - Intergenic
963630130 3:147721843-147721865 GGTAACTGTGCATTGGGAAAAGG + Intergenic
963661211 3:148130756-148130778 GGTAACTATGCACTGGGGAAAGG + Intergenic
964432992 3:156624788-156624810 GTTGACTGTTCATAGGGGAATGG + Intergenic
964453446 3:156835593-156835615 GGAAAGTATGGATTGGGGAATGG - Intronic
964977382 3:162637163-162637185 GGTAACTGTGCATTGGGGAAAGG - Intergenic
965226939 3:166002151-166002173 GGTAACTCTGTATTGGGGAAAGG - Intergenic
965251689 3:166351194-166351216 GGTAACTGTGCATTGGGGGAAGG - Intergenic
965619139 3:170625048-170625070 AGTTACTGTGCATAGGGCAAGGG - Intronic
965845030 3:172951594-172951616 GGTGACTGTGAATTGGGGGCTGG + Intronic
966445500 3:179997181-179997203 GGTAACTGTGCACTGGGGAAAGG + Intronic
967831588 3:193924605-193924627 GGTAACTATGCACTGGGGAAAGG + Intergenic
968117905 3:196103743-196103765 GGTTCCTTTGCAATGGGGAATGG - Intergenic
968923847 4:3536701-3536723 GGGAACTGGGGATGGGGGAAGGG - Intergenic
969064568 4:4468272-4468294 GGTAAATGTGCATGGTGTAAGGG - Intronic
969075985 4:4578061-4578083 TGCAACTGAGCATTAGGGAAAGG + Intergenic
969860167 4:10029316-10029338 GGAGACTGTGCATCGGGGATAGG - Intronic
971250503 4:24969917-24969939 GTTGACTGTTCATAGGGGAAAGG + Intronic
971817044 4:31503682-31503704 GGTAACGGTGCATTGGGAAAAGG + Intergenic
971979468 4:33734244-33734266 GGTAACTGTGCATTGGGGAAAGG - Intergenic
972085053 4:35205701-35205723 GGTAACTGTGCGCTGGGGAAAGG + Intergenic
972805705 4:42527963-42527985 GGTAACTTTGCACTGGGGAAAGG + Intronic
972883152 4:43449538-43449560 GGTAACTGTGCATTGGGGGAAGG - Intergenic
973102761 4:46293381-46293403 GGGAGCTGTGCACTGGAGAAAGG + Intronic
973118260 4:46487661-46487683 GGTAAGTGTGCATTGGGGAAAGG + Intergenic
973130368 4:46641068-46641090 GGTAATTGTGCACTGGGGAAGGG - Intergenic
974262554 4:59543662-59543684 GGTAACTGTGCACTGGGGAAAGG - Intergenic
974289408 4:59911374-59911396 GGTAACTATGCAGTGGGGAAAGG + Intergenic
974458995 4:62163856-62163878 GGTAACTGTGCATGGGGGAAAGG + Intergenic
974644795 4:64676157-64676179 GGTAACTGTGCATTGGGGAAAGG - Intergenic
974747092 4:66090305-66090327 GGTAACTGTGCACTGGGGAAAGG - Intergenic
975024298 4:69530239-69530261 GGTAACTGTGCATTGGGGAACGG + Intergenic
975982802 4:80178658-80178680 CGTAACTGTGCACTGGGGAAAGG - Intergenic
976034368 4:80797146-80797168 AGTAACTGTGCATTGGTGAAAGG - Intronic
977204509 4:94154236-94154258 GGTAACTGTGCACTGGGAAAAGG + Intergenic
977362409 4:96023099-96023121 AGTGACTGTGCACTGGGGAAAGG + Intergenic
977430578 4:96926839-96926861 GGTAACTGTGCATTGGGAACAGG + Intergenic
977465810 4:97382005-97382027 GGTAATTGTGGCTTGGGGAAAGG + Intronic
977490265 4:97701452-97701474 GTTAACTGTGCATTGGGGAAAGG - Intronic
977509640 4:97946297-97946319 GCAAACTATGCATTGGGCAAAGG - Intronic
977729907 4:100338764-100338786 GGTAACTGTTCACTGAGGAAAGG + Intergenic
977833453 4:101619560-101619582 AGTGACTATGCATTGGGGAAAGG - Intronic
977976894 4:103276489-103276511 GGTAACTGTTCATTGAGGAAAGG - Intergenic
978341837 4:107727644-107727666 GGTAATTGTGCATTGGGGAAAGG - Intergenic
978899257 4:113928222-113928244 TGTAACTGAGCATTGGGGAAAGG - Intronic
978966673 4:114749556-114749578 GGTAACTGCACACTGGGGAAAGG + Intergenic
979017892 4:115458294-115458316 GATAACTGTGCACTGGGGAAAGG - Intergenic
979075030 4:116260321-116260343 GGTAATTGTGTATTGGAGAAGGG + Intergenic
979121332 4:116905599-116905621 GGGTACTGTGCATTGGGGGCAGG - Intergenic
979562751 4:122118886-122118908 GGTAACTATACACTAGGGAAAGG + Intergenic
979766827 4:124473204-124473226 GGTAACTGTACACTGGGGAAAGG + Intergenic
979888727 4:126063531-126063553 TGTAACTGTGCATTGGTGAAAGG - Intergenic
980386436 4:132091874-132091896 GGTAACTGTGCATTGGGGAAAGG - Intergenic
980406071 4:132355184-132355206 GGTAACTGTGCACTGGGGATAGG - Intergenic
980497719 4:133606758-133606780 GTTAACTGTGCACTGGGGACAGG - Intergenic
980582412 4:134772177-134772199 GTTAACTGTACATTGGGAAAAGG - Intergenic
980601980 4:135038090-135038112 GGTAATTGTGCATTGGGGAATGG + Intergenic
980629363 4:135412888-135412910 GGTGACTGTGCATTGGGGAAAGG + Intergenic
980691799 4:136305044-136305066 GGTGACTGTGCAATGGGGAAAGG - Intergenic
980957551 4:139444543-139444565 TAAAACTGTGCACTGGGGAAAGG + Intergenic
980979215 4:139639706-139639728 GGCAACTGGGCAGTTGGGAAAGG + Intergenic
981834808 4:149042554-149042576 GGTAACTGTGCACTGGGGAAAGG + Intergenic
982472435 4:155809140-155809162 GGTAACTGAGCTTAGAGGAAAGG + Intergenic
982527022 4:156491021-156491043 GGTAACTGTGCATTGGGGAAAGG + Intergenic
982835348 4:160115259-160115281 GGTAACTGTGCACTGGGGAAAGG + Intergenic
982847591 4:160272924-160272946 GGTAACTGTGCATTAGGGAAAGG + Intergenic
983359218 4:166706728-166706750 GGTAACTGTGCATTGAGGAAAGG + Intergenic
983495130 4:168434986-168435008 GGTAACTGTCCACTGGAGAAGGG + Intronic
984061253 4:174991186-174991208 GGTAACTGTGCATTGTAGAATGG - Intergenic
984227318 4:177050788-177050810 GATAACTTTGAATTGGGGAATGG - Intergenic
984414021 4:179434071-179434093 AGTGACTGTGCACTGTGGAAGGG - Intergenic
985753378 5:1696938-1696960 GGAAAATGTTCATGGGGGAAAGG - Intergenic
985930975 5:3057690-3057712 GGTCACTGTGCGTGGGTGAACGG + Intergenic
986037223 5:3951822-3951844 GGTAACTGTGCACTGAGGAAAGG - Intergenic
986086934 5:4461329-4461351 GGTAATTGTGTATTGGAAAAGGG + Intergenic
986742733 5:10718115-10718137 AGTAACTGTGGATTGGGGAAAGG + Intronic
986937250 5:12904723-12904745 GGTAACTGTGCACTGGGGAAAGG + Intergenic
986938504 5:12920124-12920146 GGTAACTGTGCACTGGGGAAAGG - Intergenic
986959645 5:13197812-13197834 GGTATCTGTGCAATGGGCAAAGG + Intergenic
987152994 5:15060282-15060304 GGTAACTGTGCCCTGGGGAAAGG + Intergenic
987504219 5:18748478-18748500 GGTAGCTGTGCAATGGGGAAAGG + Intergenic
987578527 5:19759702-19759724 GTTAACCATGCATTGGGGAAAGG - Intronic
987657300 5:20823025-20823047 GGTAACTGTGCTTTGGAGAAGGG - Intergenic
988080006 5:26402807-26402829 GGTAACTGTGCACTGGGGAAAGG - Intergenic
988092425 5:26561214-26561236 GGTAACTGTGCACTCGAAAAAGG + Intergenic
988107579 5:26771138-26771160 GGTAACTGTGCACTGGGGAAAGG + Intergenic
988169368 5:27634194-27634216 GGTAATTGTGCACTGGGGAAAGG - Intergenic
988188601 5:27899870-27899892 TGTAACTGTGCACTGGGGAAAGG + Intergenic
988228596 5:28446768-28446790 GGTCACTGTGCACTGGGGAAAGG + Intergenic
988233458 5:28508461-28508483 GGTAACTGTGCACTGGGGAAAGG - Intergenic
988267676 5:28972742-28972764 GGTAACTGTGCATTGGGGAAAGG - Intergenic
988275716 5:29079161-29079183 GGTGACTGTGCATTGGGGAAAGG - Intergenic
988309877 5:29543362-29543384 CATAACAGTGCTTTGGGGAAGGG + Intergenic
988561945 5:32289497-32289519 GGTAAGTGTGCACTGGGGAAAGG + Intronic
988766246 5:34380923-34380945 GGTAACTGTGCTTTGGAGAAGGG + Intergenic
988971485 5:36472751-36472773 GGCTACTGTGCATTTGGGATAGG + Intergenic
988995479 5:36710963-36710985 CTCAACTGTGCATTGGGAAAAGG - Intergenic
989045408 5:37268982-37269004 GGTAACTGTGCATCAGGGAAAGG - Intergenic
989097644 5:37795949-37795971 GGTAACTGTGCACTGGGGAAAGG + Intergenic
989135380 5:38149282-38149304 GGTAACTAAGCATTGGGGGTTGG + Intergenic
989307670 5:39975943-39975965 GGTAACTGTGCACTGGGGACAGG - Intergenic
989457830 5:41663155-41663177 GGTAACTGTGCACTAGGGAAAGG - Intergenic
990220574 5:53584072-53584094 AATAACTGTGCATTGGGGAGTGG - Intronic
990657551 5:57973811-57973833 GGTCATTGCGCATTGGAGAAAGG - Intergenic
991014000 5:61912291-61912313 GGTCACTGTGCTTTAGGGAAAGG - Intergenic
991234426 5:64377482-64377504 GTTGACTGTGCACTGGGGAAAGG - Intergenic
991945963 5:71898748-71898770 GGTAACTGTGCACTGGAGAAAGG + Intergenic
992242688 5:74788053-74788075 GGTAACTGTGCACTGGGGAAAGG + Intronic
993232085 5:85248928-85248950 GGTAACTGTACCCTGGGGAAAGG - Intergenic
993412756 5:87593197-87593219 GGTAACTGTGCATTGGAGAAAGG - Intergenic
993780524 5:92061006-92061028 GGTAACTGTGCACTGGGGAAAGG + Intergenic
994587476 5:101728098-101728120 AGTGTCTGTGCATAGGGGAAGGG - Intergenic
994958281 5:106562946-106562968 GGTAACTGTGCACTGGGGAAAGG + Intergenic
994984597 5:106917106-106917128 GGTAACTATGCACTGGGGAAAGG - Intergenic
995275976 5:110278256-110278278 AGTATCTGTGCATTTGGGTATGG + Intergenic
995427922 5:112045114-112045136 GGTAACTGTGCACTGGGGAAAGG - Intergenic
995776468 5:115729059-115729081 GGCAACTGTGCACTGGGGAAAGG - Intergenic
995794043 5:115923507-115923529 GGTAACTGTGCACTGGGTAATGG + Intergenic
996084401 5:119289694-119289716 GGTAAATGGGCATTGGAGCAAGG - Intronic
996331358 5:122332747-122332769 GGTAAAAGTGAAGTGGGGAATGG + Intronic
996825379 5:127676444-127676466 GGTAACTGTGCATTGGGAAAAGG + Intergenic
996908872 5:128633406-128633428 GGTAACTGTGCATTAGGGAAAGG - Intronic
997446073 5:133941351-133941373 GGTATGTGTGCAGTGGGAAAAGG + Intergenic
997601633 5:135142625-135142647 GGCAGCTGTGCTTTGGGGAAGGG - Intronic
997844008 5:137269492-137269514 GGTCACTGAGCATGGGGGAGGGG + Intronic
998666495 5:144304245-144304267 GGTAATAGTGCTGTGGGGAAAGG + Intronic
998955330 5:147432476-147432498 GGTCACAGTGGATGGGGGAATGG + Intronic
999328618 5:150658396-150658418 GGTCAGAGTGCACTGGGGAAGGG - Intronic
999351208 5:150873469-150873491 GATAACTATGCACTGGGGAAAGG + Intronic
999997315 5:157104644-157104666 GGTAACTATGCATGGGGCAGAGG - Exonic
1000223433 5:159235662-159235684 GGTAGCTGTGCACTGGGGAAAGG - Intergenic
1000408062 5:160909562-160909584 GGTAACTGTGCATTTCCCAATGG + Intergenic
1000621766 5:163494270-163494292 CGTAACTGTGCATTAGAAAAAGG - Intergenic
1000871117 5:166578812-166578834 GATAACTGTGTACTGGGGAAGGG - Intergenic
1001362730 5:171103805-171103827 AGGAACTGTGCCTTGAGGAACGG - Intronic
1001965116 5:175904543-175904565 GATAACTGTGTACTGGGGAAGGG + Intergenic
1002251836 5:177934645-177934667 GGTAACTGTGTACTGGGGAAGGG - Intergenic
1002997782 6:2303358-2303380 GGTAACTGTGCACTGGGGAAAGG + Intergenic
1003414807 6:5898286-5898308 GATAACTGTACACTGAGGAAAGG - Intergenic
1004824478 6:19404618-19404640 AGTAACTGTGCATTGGGGAAAGG - Intergenic
1005577917 6:27207332-27207354 AGTGACTGTGCTTTGGGAAAGGG + Intergenic
1005622651 6:27634375-27634397 GGCAACTGTGCATTGGGGAAAGG - Intergenic
1005844940 6:29769846-29769868 GGAGACTGTACATTGGGGAAGGG + Intergenic
1006001326 6:30967377-30967399 GGTAACTGTGTATTGGGGAAAGG + Intergenic
1006062159 6:31431775-31431797 GGTAACTGTGCACTGGGGAGAGG + Intergenic
1006726962 6:36206295-36206317 GGGATCTGTCCTTTGGGGAAAGG + Intronic
1007235364 6:40387438-40387460 AGTTACTTTGCATTTGGGAAGGG + Intergenic
1007285226 6:40742785-40742807 TGTGAGTGTGCATTGGGGAAGGG - Intergenic
1008351469 6:50496404-50496426 AGTAAGTATGCATTGTGGAATGG + Intergenic
1008400108 6:51054109-51054131 GGTAACTGTTCACTGGGGAAAGG + Intergenic
1009390295 6:63136465-63136487 GGTAACTGTGCATTGGGAAAAGG - Intergenic
1009787170 6:68354879-68354901 GGTAACTGTGCATTGAGGAAAGG - Intergenic
1009806314 6:68605564-68605586 GGTAACTGTGCACTGGGAAAAGG + Intergenic
1010108181 6:72192305-72192327 GGTAACTGTGCACTGGAGGAAGG - Intronic
1010325509 6:74557979-74558001 GGTAACTGTGCATTGGGAAAAGG - Intergenic
1010407133 6:75518158-75518180 GGTAACTGTGCATTGGGGAAAGG - Intergenic
1010504940 6:76645510-76645532 GGTGACTATGCATTAGGGGAGGG - Intergenic
1010818442 6:80387015-80387037 GGTAACTGTGCATTGGGTAAAGG + Intergenic
1011039538 6:83014666-83014688 GCTAACTGTTCACTGGGGATAGG - Intronic
1011068915 6:83360283-83360305 GGTAACTGTGCACTGGGGAAAGG + Intronic
1011305170 6:85917599-85917621 GTTGACTGTGCATTGGGGAAAGG + Intergenic
1011331021 6:86206617-86206639 GGTAACTGACCATTGAGGAATGG - Intergenic
1012001749 6:93663077-93663099 GGTAACTGTGCATTAGGGAAAGG + Intergenic
1012033235 6:94099627-94099649 AATAACTGTGCATTGGGAAAAGG + Intergenic
1012205483 6:96455841-96455863 GGTAACTGTACACTGAGAAAAGG + Intergenic
1012730279 6:102872933-102872955 GGTAACTGTGCACTGAGGAAGGG + Intergenic
1012820618 6:104081535-104081557 GGTAACTGTGCAACGAGGAAAGG + Intergenic
1013551103 6:111208601-111208623 GGTAACTGTGAAGAGTGGAATGG + Intronic
1014333699 6:120103429-120103451 GGTAACCATACACTGGGGAAAGG + Intergenic
1014416816 6:121194007-121194029 GGTAACTGTGAATTGGGGAAAGG + Intronic
1014534387 6:122598007-122598029 GGTAACTGTGCAGTGGGGAAAGG - Intronic
1014631473 6:123795412-123795434 GGTAACTGTGCAATGGGGAAAGG + Intergenic
1014970079 6:127802830-127802852 GGTAACTGTGCATTGTGGAAAGG + Intronic
1015467115 6:133559614-133559636 GGCATCTGTGCACTGGGAAAAGG - Intergenic
1015926926 6:138320147-138320169 GGTACCTGTGCATTAGGAGAAGG + Intronic
1015995397 6:138991234-138991256 GATAAATGTGCATTGGGTAAGGG - Intergenic
1016147501 6:140694115-140694137 GGTAACTGTGCATTGGAGAAAGG - Intergenic
1016175069 6:141070434-141070456 GGTAACTATGCGTTGGGGAAAGG - Intergenic
1016186955 6:141209063-141209085 GGTAACTTTATATTGGGGAAAGG - Intergenic
1016220019 6:141656236-141656258 GGTAACTCTGCACTGGGGAAAGG + Intergenic
1016571294 6:145515918-145515940 GGTGACTATGCACTGGGCAAAGG + Intronic
1017223246 6:151990672-151990694 GGTTACTGTACATTGTGGGAGGG + Intronic
1017228001 6:152042467-152042489 GGTAACTGTGCACTGGGGAAAGG - Intronic
1017408937 6:154148999-154149021 GGCAAGTGTACAATGGGGAAGGG - Intronic
1017861485 6:158402249-158402271 GGTAACTGAGGGGTGGGGAAGGG - Intronic
1017977299 6:159369448-159369470 GGTAACTGTGCACTGGGGAAAGG - Intergenic
1018107513 6:160503186-160503208 GGTAACTGTGCACTGGGGACAGG - Intergenic
1018535194 6:164811858-164811880 GGTAACTGTGCGTTGGGGAAAGG - Intergenic
1018569772 6:165196687-165196709 GTTAACCGTGCACTGGGGAAAGG + Intergenic
1018599698 6:165526138-165526160 GGTAACTGTGTACTGGGGAAAGG + Intronic
1018614508 6:165674139-165674161 GGGAACTGTGGAATGGGAAAGGG - Intronic
1020603215 7:10302833-10302855 AGTAACTGTACACTGGGGAAAGG - Intergenic
1020710152 7:11596230-11596252 GGTAACTGTGCATTGGGAAAGGG + Intronic
1020873510 7:13664823-13664845 ACTAAATGTGAATTGGGGAAAGG - Intergenic
1021099458 7:16571628-16571650 AGGGACTGTGCCTTGGGGAACGG + Intronic
1021788624 7:24177559-24177581 GTTTACAGTGCAGTGGGGAAAGG + Intergenic
1022078702 7:26998937-26998959 AGTACCTGTGCATTCTGGAAAGG + Intergenic
1022288237 7:28975781-28975803 GGTAACTGTGTACTGAGGAAGGG + Intergenic
1022393653 7:29965463-29965485 TGTCCCTGTGCATTGGGGATGGG + Intronic
1024040066 7:45546085-45546107 GGTAACTATACATTGGGGAAAGG - Intergenic
1025156066 7:56606658-56606680 GGTAACTGTGCATTTGGGAAAGG - Intergenic
1025761993 7:64404128-64404150 GGTAATTGTGTAGTGGGGAAAGG + Intergenic
1026239400 7:68559159-68559181 GGTAACTATACACTGGGAAAAGG - Intergenic
1026999589 7:74643304-74643326 ATAAACTGTGCATGGGGGAAAGG - Intergenic
1027990827 7:85359002-85359024 GGGAAATGTGCAATGGGGCAAGG + Intergenic
1028043681 7:86090077-86090099 GGTAGCTGTGCACTGGGGAAAGG + Intergenic
1028196528 7:87913829-87913851 GGTAACTGTGCACTGGGAAAAGG - Intergenic
1028237644 7:88381465-88381487 GGTAACTGTGCATTGGGGAAAGG + Intergenic
1029961054 7:104689656-104689678 AGTAACTGTGCATTGGGAAAAGG + Intronic
1030277274 7:107734711-107734733 GGTAACTGTATCTTGGGGAAAGG + Intergenic
1030312477 7:108082412-108082434 GATAACTGTCTATTGGGGAAGGG + Intronic
1030368566 7:108672645-108672667 AGTAAGTGTGCACTGGGGAAAGG + Intergenic
1030457641 7:109794424-109794446 GGTGACTGTGCAATGGGGAAAGG - Intergenic
1030548640 7:110931102-110931124 GGTAACTATGGATGGTGGAAAGG + Intronic
1030626039 7:111847288-111847310 AGGAATTGTGCATTAGGGAAAGG - Intronic
1031236659 7:119186624-119186646 GGTAACAGTGCATTGGGGAAAGG + Intergenic
1031474633 7:122206723-122206745 GGTAGCTGTGCACTGGGTAAAGG - Intergenic
1031538045 7:122959402-122959424 AGTTACTATGCATTGAGGAAAGG - Intergenic
1031676373 7:124616943-124616965 AGTAACTGTGCATTGGAAAAAGG + Intergenic
1032124776 7:129185410-129185432 GGAAACTGTTCAGTGGGGACTGG - Intergenic
1032153292 7:129448327-129448349 GGTAACTGTGCACTGGGGAAAGG - Intronic
1032464633 7:132136308-132136330 GCTGGCTGTGCATTGAGGAAGGG + Intronic
1032480598 7:132243675-132243697 GGAAACTGTGAATTGGGGTGGGG - Intronic
1032630307 7:133643910-133643932 GGTAACTGTACATTGGGGAAAGG - Intronic
1032923604 7:136577183-136577205 GGTAACTGTGCACAGGGGAAAGG - Intergenic
1033076074 7:138251670-138251692 GGTAACTGTGCATTGGGGAAAGG + Intergenic
1033551324 7:142450961-142450983 TGTATCTGTGCATTGATGAAAGG - Intergenic
1033553589 7:142469529-142469551 TGTATCTGTGCATTGATGAAAGG - Intergenic
1034535439 7:151723175-151723197 GGCAACTGGGCATTAGGGAAAGG - Intronic
1034612541 7:152384814-152384836 TGTAACTGTTCATATGGGAAAGG - Intronic
1035941852 8:3910074-3910096 GCTAACATGGCATTGGGGAAAGG + Intronic
1038504289 8:28071266-28071288 GTTAAGTGTGCAGTGAGGAAAGG + Intronic
1038723590 8:30059721-30059743 GGTAACTATGCCCTGGGGAAAGG - Intergenic
1039549932 8:38436076-38436098 GTTAACAGTGCATTGCGGACTGG + Intronic
1040916305 8:52569168-52569190 GGTAACTGTGCACTGGGAAAGGG - Intergenic
1040916316 8:52569219-52569241 GGTAACTGTGCATTGGGAAAGGG - Intergenic
1041121608 8:54591811-54591833 GGTAACTGGGCACTGGGGCTAGG + Intergenic
1041274589 8:56143670-56143692 GGTAACTGTGCATGAGGGAAAGG - Intergenic
1041564420 8:59260900-59260922 GGTAACTCGGGATTGGGGATGGG - Intergenic
1041578413 8:59427350-59427372 GGAAACTGTGCATAGGTGAGTGG + Intergenic
1041934352 8:63319840-63319862 GGTAACTGTGCACTAGAGTAAGG + Intergenic
1043257818 8:78157976-78157998 GGAAACTGTCCATTAGGGAAAGG + Intergenic
1044150620 8:88771690-88771712 GGTAACTTTGCATTGGGGAAAGG + Intergenic
1044202213 8:89451097-89451119 GGTAAATGTGTATTGGGAAAAGG + Intergenic
1044286150 8:90413837-90413859 GGTAACTGTGCATTGGGGAAAGG - Intergenic
1044487339 8:92768513-92768535 GGTAACCGTGCACTGGGGAAAGG - Intergenic
1044633602 8:94301169-94301191 GGTAACTGTGCACTGGGGAAAGG - Intergenic
1044750242 8:95408844-95408866 GGTGACTGTGCAATGGAGAAAGG + Intergenic
1046050953 8:109022030-109022052 GATAAATGAGAATTGGGGAAGGG + Intergenic
1046104846 8:109653045-109653067 GGTCATTGTGAATTGAGGAAGGG - Intronic
1046128852 8:109942987-109943009 GGTAATTGTGCATTGGGGAAAGG - Intergenic
1046197386 8:110882857-110882879 GGTAACTGTGCATTGGAGAAAGG + Intergenic
1046417833 8:113939199-113939221 GGTAACTGTACACTAGGGAAAGG - Intergenic
1046585960 8:116149023-116149045 GGTAACTGTGCACTGGGGAAAGG - Intergenic
1047816831 8:128473821-128473843 GGCATCTGTGCAGTGGGGAACGG - Intergenic
1047830320 8:128622421-128622443 GGAAACTGAGAATTAGGGAAGGG + Intergenic
1048084030 8:131158232-131158254 GGCAACTGTGCATTAGGAGAAGG - Intergenic
1048606963 8:135978986-135979008 GGAAACTGAGCTGTGGGGAAGGG + Intergenic
1049705672 8:144040893-144040915 GGGAATTATGCATTCGGGAAGGG - Exonic
1050063731 9:1737348-1737370 AGTAATTGTGAACTGGGGAAAGG - Intergenic
1050239953 9:3624560-3624582 AGGAACTGTGCAGTGAGGAATGG - Intergenic
1050482489 9:6101233-6101255 GGTAACTGTGCACTGGGGAAAGG + Intergenic
1050826509 9:9952681-9952703 GATAACTATTCACTGGGGAAAGG + Intronic
1051369047 9:16342650-16342672 GGTATCTGTGCATAGAGAAAAGG + Intergenic
1051881960 9:21849269-21849291 GGTAACTGTGCACTGGGGAAAGG + Intronic
1051966268 9:22833204-22833226 GGTAACTCTGCATTGGGAAATGG + Intergenic
1052227421 9:26106983-26107005 GGTAACTGTGCATTGTGGAAAGG + Intronic
1052368460 9:27639445-27639467 GGTAACTATGCATTGGGAAAGGG + Intergenic
1054145657 9:61559272-61559294 GGGAACTGGGGATGGGGGAAAGG + Intergenic
1054187970 9:61967786-61967808 GGGAACTGGGGATGGGGGAAGGG - Intergenic
1054465396 9:65490376-65490398 GGGAACTGGGGATGGGGGAAAGG + Intergenic
1054650545 9:67620795-67620817 GGGAACTGGGGATGGGGGAAGGG + Intergenic
1054768835 9:69066199-69066221 GTTGACTGTGAATTGGGAAAGGG + Intronic
1056314426 9:85374336-85374358 GGTAACTGTGCATTAGGGAAAGG - Intergenic
1056661558 9:88547368-88547390 GGTCACTGTGCACTGGAGAGGGG + Intronic
1058019703 9:100074688-100074710 GGTAACTGTGCATTGGAGAAAGG + Intronic
1060321307 9:122564060-122564082 GGTAACTGTGCATTGGGAAAAGG + Intergenic
1061488450 9:130932478-130932500 GGGAACTGTGCATTTGGGTCTGG - Intronic
1061606279 9:131713335-131713357 GGAATCTGTGAAATGGGGAAGGG - Intronic
1062562809 9:137149322-137149344 TGTGACTGTGGAATGGGGAAGGG - Intronic
1186469957 X:9813468-9813490 GGTAACTGTGCATTGGGGAAAGG - Intronic
1186515422 X:10163280-10163302 GGAAAGTGTGTATGGGGGAAGGG - Intronic
1187202083 X:17144779-17144801 GGTGACTGTGCATTAGAGGAAGG + Intronic
1187604703 X:20870679-20870701 GGTAACTCTGCATTGGGGAAAGG + Intergenic
1187673941 X:21697181-21697203 AGTAAATGTGCACTGGGAAAGGG - Intergenic
1188762402 X:34049043-34049065 GGTAGTTATACATTGGGGAAAGG + Intergenic
1189689848 X:43604446-43604468 GATAACTGTAAAGTGGGGAAGGG - Intergenic
1190538191 X:51449809-51449831 GGTAACTATGCATTGGGGAAAGG + Intergenic
1191134136 X:57045342-57045364 AGTAACTGTGCATTGGGAAAAGG - Intergenic
1191226559 X:58050298-58050320 GGTAATTGTGCATTGTAGAAAGG + Intergenic
1191630291 X:63314650-63314672 AGTAACTGTGCATTGGGGAAAGG - Intergenic
1191658995 X:63631369-63631391 GGTAACTGTACATTGGGAAAAGG - Intergenic
1191941432 X:66485246-66485268 AGTAACTGTACATTCTGGAAAGG - Intergenic
1191988362 X:67006020-67006042 GGTAACTGTGCATTGGAAAAAGG - Intergenic
1192297889 X:69869390-69869412 GGTAACTGTGCACTGGGGAAAGG - Intronic
1192658059 X:73013128-73013150 AGTAAATATACATTGGGGAAAGG - Intergenic
1192661742 X:73049144-73049166 GGTAACTCTGCACTGGGGAAAGG - Intergenic
1192936929 X:75870243-75870265 GGAAACTGTGCATTAGGGTTTGG + Intergenic
1193053239 X:77123795-77123817 GATAACTGTGCACTGGGGAAAGG + Intergenic
1193084605 X:77438085-77438107 GGTACCTGTACATAAGGGAAGGG - Intergenic
1193446985 X:81617395-81617417 GGTAACTGTGCACTGGGGAAAGG + Intergenic
1193573866 X:83176388-83176410 TGTAACTGTGCAATGGGGAAAGG - Intergenic
1193685369 X:84571414-84571436 GGGAACTGTGCTGTGAGGAATGG + Intergenic
1193832767 X:86308723-86308745 GGTAACTGTGCACTGGGGAAAGG + Intronic
1193841584 X:86413985-86414007 GATAACTGTGCATTGGGAAAAGG - Intronic
1193914993 X:87353320-87353342 AGTAACTGTGCACTGGGGAAAGG - Intergenic
1194032178 X:88831244-88831266 GGTAACTGTGCACTGAGGAAAGG - Intergenic
1194210099 X:91060978-91061000 GGTAACTGTGCATTGAGGAAAGG + Intergenic
1194343139 X:92729713-92729735 GGTAACTATGCATTGGGGAAAGG + Intergenic
1194513598 X:94823633-94823655 GGTAACTGTGCATTGCAGAAAGG - Intergenic
1194604575 X:95963368-95963390 AGTAACTGTGCGTTGGAGAAAGG - Intergenic
1194671897 X:96743686-96743708 GGTAATTGGGCAGTGGGGAGAGG + Intronic
1194833767 X:98657408-98657430 GGTAACTGTGAATTGGGGAAAGG + Intergenic
1195437744 X:104864798-104864820 GATAGATGTGCAGTGGGGAAAGG + Intronic
1195661690 X:107385023-107385045 GGGAAGTGTGAAGTGGGGAAGGG + Intergenic
1195749027 X:108146034-108146056 GGTAACTGTGCATTGGGGGAAGG - Intronic
1195782548 X:108481257-108481279 GGTAACTATGCATTGGGGAGAGG - Intronic
1195809843 X:108817209-108817231 GGTAATTGTGCACTGGGGAAAGG - Intergenic
1196100122 X:111839070-111839092 GGGAACTGTGGAATGGGTAAGGG - Intronic
1196372526 X:114995501-114995523 GGTAACTGTGCATTAGGAAAGGG - Intergenic
1196529044 X:116761755-116761777 GGCAACTGTGAATTGGGGAAAGG + Intergenic
1197002105 X:121451566-121451588 GGTAACTGTGCATTAGGAAAAGG + Intergenic
1197044274 X:121977059-121977081 GGTAACTATACATTGAGGAATGG + Intergenic
1197084378 X:122454890-122454912 AGTAACTGTGCACTGGGGAAAGG - Intergenic
1197097285 X:122611451-122611473 GATAAGTGTGCATTGAGGAAAGG + Intergenic
1197245289 X:124160696-124160718 GGTAACTGTGCACTGGGGAAAGG - Intronic
1197380179 X:125729322-125729344 GGTAACTGTGCGTTAGGAAAAGG - Intergenic
1197380527 X:125732653-125732675 GGTAACTGTGCATTGGGAAAAGG - Intergenic
1197386988 X:125814058-125814080 AGTAACTGTGCATTGGGGAAGGG - Intergenic
1197425929 X:126297007-126297029 GGTAACTGTGCATTGGGGAAAGG - Intergenic
1197554441 X:127936937-127936959 GATAACTGTGCATTGGGGAAAGG - Intergenic
1197591685 X:128417956-128417978 GGTAACTGTGCATTGGGGGAAGG + Intergenic
1198186517 X:134258736-134258758 GGTAACTGTGCACTAGAGAAAGG - Intergenic
1198701108 X:139398903-139398925 GGTAACTGTGCATTGGGGAAAGG + Intergenic
1198933833 X:141886462-141886484 GGTAACTGTGCACTGGGGAAAGG + Intronic
1198969267 X:142263311-142263333 GGGAACTTTGCAGTGGGTAAGGG - Intergenic
1199144626 X:144350353-144350375 AGCAACTGTGCATTGGAGAAAGG - Intergenic
1199198424 X:145059237-145059259 GGTAAGTGCACATTGTGGAAAGG + Intergenic
1199627262 X:149751979-149752001 AATAACTGTGCATTGGGGAAAGG - Intergenic
1200521116 Y:4210654-4210676 GGTAACTGTGCACTGGGGAAAGG + Intergenic
1200526427 Y:4279501-4279523 AGTCACTGTGTATTGGGAAAGGG - Intergenic
1200651497 Y:5846379-5846401 GGTAACTATGCATTGGGGAAAGG + Intergenic
1201798277 Y:17925314-17925336 GGTAACTGTGCATGGAAGAAAGG + Intergenic
1201803276 Y:17980643-17980665 GGTAACTGTGCATGGAAGAAAGG - Intergenic
1202100250 Y:21299994-21300016 GGTAACTGTGCACTGGGGAAGGG + Intergenic
1202341255 Y:23871281-23871303 GGTGACTGTGCATTAGGGAAAGG - Intergenic
1202529511 Y:25798805-25798827 GGTGACTGTGCATTAGGGAAAGG + Intergenic