ID: 1067332966

View in Genome Browser
Species Human (GRCh38)
Location 10:45338856-45338878
Sequence GTAACTGTGCATTGGGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 787
Summary {0: 42, 1: 162, 2: 135, 3: 138, 4: 310}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067332959_1067332966 -4 Left 1067332959 10:45338837-45338859 CCTCCAGCCTTTTATCAAGGTAA No data
Right 1067332966 10:45338856-45338878 GTAACTGTGCATTGGGGAAAGGG 0: 42
1: 162
2: 135
3: 138
4: 310
1067332955_1067332966 15 Left 1067332955 10:45338818-45338840 CCATTTTTTCCCAAGGAGACCTC No data
Right 1067332966 10:45338856-45338878 GTAACTGTGCATTGGGGAAAGGG 0: 42
1: 162
2: 135
3: 138
4: 310
1067332956_1067332966 6 Left 1067332956 10:45338827-45338849 CCCAAGGAGACCTCCAGCCTTTT 0: 40
1: 69
2: 120
3: 136
4: 273
Right 1067332966 10:45338856-45338878 GTAACTGTGCATTGGGGAAAGGG 0: 42
1: 162
2: 135
3: 138
4: 310
1067332954_1067332966 16 Left 1067332954 10:45338817-45338839 CCCATTTTTTCCCAAGGAGACCT No data
Right 1067332966 10:45338856-45338878 GTAACTGTGCATTGGGGAAAGGG 0: 42
1: 162
2: 135
3: 138
4: 310
1067332957_1067332966 5 Left 1067332957 10:45338828-45338850 CCAAGGAGACCTCCAGCCTTTTA 0: 45
1: 69
2: 113
3: 129
4: 263
Right 1067332966 10:45338856-45338878 GTAACTGTGCATTGGGGAAAGGG 0: 42
1: 162
2: 135
3: 138
4: 310
1067332960_1067332966 -7 Left 1067332960 10:45338840-45338862 CCAGCCTTTTATCAAGGTAACTG No data
Right 1067332966 10:45338856-45338878 GTAACTGTGCATTGGGGAAAGGG 0: 42
1: 162
2: 135
3: 138
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067332966 Original CRISPR GTAACTGTGCATTGGGGAAA GGG Intergenic
900809730 1:4792935-4792957 GAAACCGTGCCCTGGGGAAAGGG + Intergenic
901904244 1:12394034-12394056 GTAACTGTGCACTGGGGAAAGGG - Intronic
901942615 1:12675238-12675260 GTGACTGTGCACAGGAGAAAAGG - Intergenic
902954268 1:19914140-19914162 GTTTCTGTGCATTGGAGGAAGGG - Intergenic
903119763 1:21207967-21207989 GTGACTGCATATTGGGGAAAAGG + Intergenic
903922844 1:26813360-26813382 GCAACTGTGCGGTGGGGAAAAGG + Intergenic
904179723 1:28657659-28657681 TTAATTGTGCATTAGGGAAAGGG - Intergenic
904335739 1:29796625-29796647 GTAACTGTGCATTGGGCAAAGGG + Intergenic
905465032 1:38146743-38146765 GTAACTGTGCACTGGGGAAAGGG + Intergenic
906018438 1:42604687-42604709 GGGACTGGGCATTGGAGAAAGGG - Intronic
906879500 1:49575106-49575128 GTAACTGTGCAACTGGGGAAAGG + Intronic
907491108 1:54809381-54809403 GTAACTGTACCTTAGGGAGAGGG + Intronic
907597160 1:55730726-55730748 GTAATTGTGCATAGGGGAAAGGG + Intergenic
907780158 1:57559471-57559493 GTAACTGTGCATTGGGGAAAAGG + Intronic
907854128 1:58284541-58284563 GTAACTGTGCCATGGGCACAAGG - Intronic
908183256 1:61626898-61626920 GTAATTGTGCACTGGGGAAAAGG + Intergenic
908271808 1:62429797-62429819 GTAATTGTACCCTGGGGAAATGG - Intergenic
908737375 1:67290723-67290745 GTAACTGTGCACTGGGGAAAGGG + Intergenic
909549138 1:76878525-76878547 GTACCTGTGCACTGGGGAAAGGG - Intronic
909576726 1:77184497-77184519 GTAACTGTGCACTGCGGAAAGGG + Intronic
909810816 1:79930196-79930218 GTAACTGTGCATTGGAAAAATGG + Intergenic
909963330 1:81875857-81875879 TTAACTGTGCATTAGAGAGACGG - Intronic
910424651 1:87108491-87108513 GCAACTTTGCATAGGGTAAACGG - Exonic
910486414 1:87719659-87719681 GCAACTGTGCAGAGGGGAGATGG + Intergenic
910561732 1:88598635-88598657 GTAACTGTGCATTGGGGAAAGGG + Intergenic
910588031 1:88900377-88900399 GTAATTGTGCACTGGGGAAAGGG + Intergenic
910831282 1:91464762-91464784 GCAACTGTGCACTGGGGAGAGGG - Intergenic
911109290 1:94165559-94165581 GTAACAGTGCATTGGGGAAAAGG - Intronic
911113599 1:94219024-94219046 GAAACTCTTCTTTGGGGAAAGGG - Intronic
911883385 1:103269105-103269127 TTAACTATGCAATGGGGAAAGGG + Intergenic
912050849 1:105526304-105526326 GTAACTGTGCACTGGGGAAAGGG - Intergenic
912066856 1:105755584-105755606 GTAACTGGGAATTGGAGAAAGGG + Intergenic
912733506 1:112130184-112130206 CTAACTGTGCATTGGGGAAAGGG - Intergenic
913039760 1:115010886-115010908 GTAATTGTGCATTAAGGAAAGGG + Intergenic
914445305 1:147745231-147745253 ATAACTGTGCACTGGGGGAGAGG + Intergenic
915035559 1:152920790-152920812 GCAACTGTACTTTGGAGAAAGGG - Intergenic
915623395 1:157099547-157099569 GTGTCTGGGCCTTGGGGAAATGG + Exonic
915667849 1:157461010-157461032 GTAACTGTGCGTTGGGTAAAGGG - Intergenic
916017533 1:160763366-160763388 GTAACAGTGCATGGGGGAAAAGG - Intergenic
916179663 1:162072380-162072402 GAAACAGTACATTTGGGAAAGGG - Intronic
916285134 1:163098149-163098171 GTAACTGTGCAGTGGGGAAAGGG + Intergenic
916366093 1:164029414-164029436 ATAACTATGCATTGAGGAAAAGG - Intergenic
916862610 1:168822520-168822542 GTAAGTGTGCAAAGGGGACATGG + Intergenic
916914926 1:169396205-169396227 GTAAATGTGCATTGTAGAAATGG - Intronic
916920523 1:169461327-169461349 GGAACTGTGTAGTGGAGAAAGGG - Intergenic
917217401 1:172692270-172692292 GTAACTGTGCATTGGGGAAAGGG - Intergenic
917225717 1:172779763-172779785 GTATGTGTGCGTTGGGGAAGGGG + Intergenic
917283045 1:173397381-173397403 GCAACTGTACATTGGGGAAAAGG + Intergenic
917587530 1:176442896-176442918 ATTACTGTGGAATGGGGAAAAGG - Intergenic
917764522 1:178202014-178202036 GTAACTGTGCATTGGAGAAAGGG + Intronic
918030233 1:180800718-180800740 GTGACTGTGCACTGAGGAAAAGG - Intronic
918057762 1:181037004-181037026 GAAACTGTGAATTGGCGATATGG + Intronic
918222459 1:182448085-182448107 GTAACTGTGCACTTGGGAAAAGG + Intergenic
918529395 1:185501606-185501628 ACAACTATGCATTGGAGAAATGG - Intergenic
918749010 1:188247069-188247091 GTAACTGGGCATAGGGCATAAGG - Intergenic
918755907 1:188339152-188339174 GTAACTATGCACTGGGGAAACGG - Intergenic
918774322 1:188609399-188609421 GTAACTGTGCATTGGGGAAGGGG + Intergenic
919230200 1:194763912-194763934 GTAACTGTGCACTAGGGGAAGGG - Intergenic
919241620 1:194923139-194923161 GTAACTGTGCACTGGGGAAGGGG + Intergenic
919554034 1:199029342-199029364 GTAATTGTTCACTGGGGAAAGGG - Intergenic
919642008 1:200054792-200054814 GTAACTGTGATTTAGGAAAAAGG - Intronic
920197239 1:204237005-204237027 GTGACTGTGCATTGGGGAAAGGG + Intronic
920244455 1:204577231-204577253 GTAACTATGCAGAGAGGAAAGGG + Intergenic
921364603 1:214361850-214361872 GTAGCTGTGCAGTGGGGAGTGGG - Intronic
921559562 1:216640668-216640690 GTAACTGAGCATTTAGGAATGGG + Intronic
922283833 1:224151075-224151097 GTAAGTTTTTATTGGGGAAAGGG + Intronic
923839012 1:237647027-237647049 GTAGCTGTGCCTAGGGAAAAAGG - Intronic
924147137 1:241088124-241088146 TCAACTGGGCATAGGGGAAAAGG + Intronic
924147261 1:241089125-241089147 TCAACTGGGCATAGGGGAAAAGG + Intronic
924400275 1:243672760-243672782 GTAAGTGTGCTTTTGGTAAATGG - Intronic
924840953 1:247709165-247709187 GTAACTGTACATTGGGGAAAGGG - Intergenic
924847326 1:247786590-247786612 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1063639225 10:7814209-7814231 GTAACGGTCCACTGGGGAAAGGG + Intergenic
1064486097 10:15792185-15792207 GTGACTTGGCCTTGGGGAAAAGG - Intronic
1065606800 10:27426666-27426688 GTGACTGTGCATTTGGCAAAAGG + Intergenic
1065969657 10:30796266-30796288 GTAACCATGCACTGGGGAAAGGG + Intergenic
1066167224 10:32800607-32800629 GTAACTGTGCATAGGGGAAAGGG - Intronic
1066543545 10:36475109-36475131 GTAACTGTGCATTGGGGAAAGGG + Intergenic
1067332966 10:45338856-45338878 GTAACTGTGCATTGGGGAAAGGG + Intergenic
1067754530 10:48995084-48995106 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1068073898 10:52230117-52230139 GAAACTGAGTATTAGGGAAAGGG + Intronic
1068225528 10:54102963-54102985 GTCACTGTGCACTGGGGAAAGGG - Intronic
1068447016 10:57137235-57137257 GTAACTGTACATTGGGGAAAGGG + Intergenic
1068469263 10:57439959-57439981 ATAACTGATCATTAGGGAAAAGG + Intergenic
1068837436 10:61569964-61569986 GTAACTGTGCACTGGAGAATGGG - Intergenic
1069056155 10:63847097-63847119 GAATCTGTGCATTTGGGAGAGGG + Intergenic
1069791018 10:71020940-71020962 GTAACTGTGCATTGGGGAAAGGG - Intergenic
1070445510 10:76496964-76496986 TTAACTGTGCATTGGTGGTAGGG + Intronic
1071267268 10:83975358-83975380 GTAACTGTGCATTGGGGAAAGGG - Intergenic
1071378207 10:85032072-85032094 GTAATTGAGCAATGGGGAAAGGG + Intergenic
1071518212 10:86313148-86313170 GAGACTATGCAGTGGGGAAAGGG + Intronic
1071937514 10:90547963-90547985 GTAGCTGTGCATTGGAGAAAGGG + Intergenic
1071942973 10:90609138-90609160 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1072052008 10:91714294-91714316 GTTACTGTGCCTGGGGGAAGTGG + Intergenic
1072209452 10:93233045-93233067 GTAACTGTGCATTGGGAAAAGGG - Intergenic
1072319196 10:94232594-94232616 GTAATTGTGCAGTGGGGAGATGG - Intronic
1072360286 10:94652790-94652812 GTAACTGTCCACTGGGGAAAGGG + Intergenic
1073557158 10:104464547-104464569 GTAACTGTGCACTGGGGAAAGGG + Intergenic
1073656831 10:105425597-105425619 GTAACTGTACATTGGAGAAAGGG - Intergenic
1073854915 10:107662858-107662880 GTAACTGTGCACTGGGGAAAGGG + Intergenic
1073957849 10:108892998-108893020 GTAACAGCTCACTGGGGAAAGGG - Intergenic
1074632668 10:115275394-115275416 CTAGCTATGCACTGGGGAAAGGG - Intronic
1074964293 10:118475240-118475262 GCAAGTGTGTGTTGGGGAAATGG - Intergenic
1075027742 10:118998914-118998936 GTTACTGTGCATTGGAGAAGAGG + Intergenic
1075027836 10:118999711-118999733 GTTACTATGCATTGGAGAAGAGG + Intergenic
1075219175 10:120569557-120569579 GAAAATGAGCAATGGGGAAAAGG - Intronic
1076087566 10:127648656-127648678 GTAGCTGTGCATTGGGGAAGAGG - Intergenic
1076123031 10:127951381-127951403 GTAACTGTGTGCTGGGGAGAGGG + Intronic
1076927599 10:133500587-133500609 ATAACTGTGCGCTGGGGAAAGGG - Intergenic
1077399124 11:2344615-2344637 GTAACTGTGCACTAGGAAAAGGG + Intergenic
1077934479 11:6769045-6769067 GTCACTGTGCATTGGCCAATAGG + Exonic
1079571722 11:21952119-21952141 GTTTCTGTGCACTGGGGAGAGGG + Intergenic
1081072608 11:38629739-38629761 GTAACTGTGCACTGGGAAAAGGG + Intergenic
1081110289 11:39127034-39127056 GTAACTGTGCACTGGGGAAAGGG + Intergenic
1081460552 11:43268918-43268940 GTATTTGTGAATTAGGGAAAGGG + Intergenic
1081608866 11:44546490-44546512 GTAACTGTGCACTGGGGAAAGGG + Intergenic
1082668436 11:56004693-56004715 ATAACTATGCACTGGGGAAAAGG - Intergenic
1082671521 11:56041679-56041701 GTAACTGTGCATTGGGGAAAGGG + Intergenic
1083112411 11:60424247-60424269 GGTACTGAGCATTGGGGAAAAGG - Intergenic
1084742673 11:71149798-71149820 CTAACTGTGCATAGGTGAGAGGG + Intronic
1085685772 11:78620809-78620831 GTAACTGTGCACTGGGGAAAGGG + Intergenic
1085747390 11:79126868-79126890 GTAATTGTGCACTGGAGAAAGGG + Intronic
1086259185 11:84916993-84917015 GGAAGTGTGCATTGGGGGATGGG - Intronic
1086833937 11:91599013-91599035 GTAACTGTGCACTGGGGAAAGGG + Intergenic
1087410929 11:97789525-97789547 GTAGCTGTGCATTGGGGAAAGGG - Intergenic
1088407791 11:109500039-109500061 GTAACTGTGCATTGGGGAAATGG - Intergenic
1088449168 11:109963974-109963996 GTAATTGTGTACTGGGGAAAGGG + Intergenic
1089903432 11:122012236-122012258 GTAATTGTGCACTGGGGAAAGGG + Intergenic
1090221793 11:125032957-125032979 GTAACTGTGCACTGGGAAAAGGG - Intronic
1090891918 11:130931377-130931399 GTAACTATGCATTGGGGAAAAGG - Intergenic
1091051553 11:132377365-132377387 GTAACTGTGCATTGGGGAAAGGG + Intergenic
1091179704 11:133592752-133592774 ATAACTCTGCACTGGGGGAAAGG + Intergenic
1091275966 11:134350444-134350466 GGATCTGTGCATTTGGGGAAGGG - Intronic
1091430132 12:426817-426839 GTAACTGTATACTGGGGAAGAGG - Intronic
1092093099 12:5820274-5820296 GTAACTGTGCATTGGGGAAAGGG + Intronic
1092381199 12:7998473-7998495 GTAATTGTGCATTGGGGAAAGGG + Intergenic
1092465837 12:8730660-8730682 ACAACTTTGCATTGTGGAAAGGG + Intronic
1093049105 12:14486333-14486355 GTAACTGTGCACTGGGGAAAGGG - Intronic
1093049847 12:14492339-14492361 GTAACTGTGCATTGCGGAAAAGG - Intronic
1093126539 12:15336428-15336450 GTAACCATGAAGTGGGGAAAAGG + Intronic
1093400816 12:18744632-18744654 GGAACTGGGGATAGGGGAAATGG - Intergenic
1094102347 12:26777877-26777899 GTAACTGTGCACTGGAGAAAGGG + Intronic
1094765561 12:33590407-33590429 GTTTCTGTGCTTTGGGGAAAGGG - Intergenic
1095179662 12:39132732-39132754 GTAACTGTGTCTTGGGAATAGGG + Intergenic
1095525186 12:43117023-43117045 ATAACTGTGCACTGGGGAAAAGG - Intergenic
1095856408 12:46865050-46865072 GTAACTGTGTATTGGGGAAAGGG - Intergenic
1096027189 12:48376806-48376828 GTGACTGTACATTAGGGAAAAGG + Intergenic
1096502620 12:52074119-52074141 ATAAATGTGCCTGGGGGAAAAGG + Intronic
1096511577 12:52132649-52132671 GAAACTGTAGATGGGGGAAATGG + Intergenic
1097821573 12:64133551-64133573 GTAACTGTGTAATGGGGAAAGGG - Intronic
1097843545 12:64344139-64344161 GTAACTGTGCATTTGGGAAAGGG - Intronic
1098715911 12:73828424-73828446 GTAACTGTACATTGGGCAAAGGG + Intergenic
1098730876 12:74035975-74035997 GTAACTGTGCATTGGGGAAAGGG + Intergenic
1098733127 12:74064267-74064289 GTAGCTGTCCATCGAGGAAAGGG + Intergenic
1098749660 12:74278118-74278140 GTAACTGTGCTATGGAGAAAGGG + Intergenic
1098805265 12:75014702-75014724 GTAAATGTTCATTGGTGAAAGGG + Intergenic
1098832091 12:75375409-75375431 GTAACTATGCACTGGGGAAAGGG - Intronic
1098960197 12:76731908-76731930 GCCACTTTGCATTGTGGAAAAGG - Intergenic
1099365758 12:81764078-81764100 GTAACTGTGCAATGGGGAAAGGG + Intergenic
1099375465 12:81892590-81892612 GTAACAGTGCACTGGGGAAAGGG + Intergenic
1099379855 12:81940193-81940215 GTAACTGTCCACTGGGGAAAGGG - Intergenic
1099400275 12:82194875-82194897 GTAACTGTGCACTGGGGAAAGGG + Intergenic
1099401297 12:82206081-82206103 GAAACTGTGCATTGGGAAAGGGG - Intergenic
1099526206 12:83721747-83721769 GTGACCTTGCATTGGAGAAAGGG + Intergenic
1099571808 12:84330759-84330781 TAGACTGTGCATTGAGGAAATGG - Intergenic
1099577918 12:84404074-84404096 GCAACTGTGCACTGGGGAAAGGG + Intergenic
1099665091 12:85618417-85618439 GTAACTGTGTATTGTTTAAAGGG + Intergenic
1099735605 12:86563663-86563685 GTAACTGTGCTTTGGGGATAGGG + Intronic
1099859574 12:88209998-88210020 GTAAATATGCACTGGGGAAAGGG - Intergenic
1099995227 12:89770934-89770956 GTAACTGTGTACTAAGGAAAAGG - Intergenic
1100083135 12:90876856-90876878 ATAACTGTGCACTAGGGAAAGGG + Intergenic
1100241336 12:92712991-92713013 GTAACTGTGTACTGGGGAAAGGG - Intergenic
1101534860 12:105607479-105607501 GTAACTGGGCACTGGGGAAAGGG - Intergenic
1101539441 12:105651790-105651812 ATAATTGTGCACTGGGGAGAGGG + Intergenic
1102211419 12:111130064-111130086 GTGACTGTGCACTGAGGAAAAGG - Intronic
1103035424 12:117652671-117652693 GTAACTGTGCACTGGGGAAAGGG + Intronic
1103396335 12:120610065-120610087 GTAACTGTGCACTGGGGAAAGGG + Intergenic
1105383767 13:19911519-19911541 GTGACTATGTATTGGGGAAAAGG + Intergenic
1105852863 13:24351170-24351192 GTAACTGTGCACTGGGGAAAAGG - Intergenic
1105883178 13:24621320-24621342 GTACATCTGCATTTGGGAAAAGG + Intergenic
1106046410 13:26146119-26146141 ATAACTGTGCACTGGGGCAAAGG - Intronic
1106826640 13:33529686-33529708 GTAATTCTGCTTAGGGGAAAAGG + Intergenic
1106857259 13:33866720-33866742 GTAACTGGGCCCTGGGAAAAAGG + Intronic
1106946962 13:34839116-34839138 GTAACTGTGCATTTAGCAACAGG + Intergenic
1107070726 13:36265961-36265983 GTGACTGTACACTGAGGAAACGG - Intronic
1107140481 13:36993304-36993326 GAAACTGTGCTTAGGGAAAAAGG + Intronic
1107429839 13:40330451-40330473 GTTACTGTGCAGTGGGCATACGG + Intergenic
1107983761 13:45757342-45757364 GTAACTGTGCATTAGGGAAAAGG - Intergenic
1108396087 13:49993301-49993323 GCAACTGTGCATAGGGGAAGGGG - Intergenic
1108843419 13:54649886-54649908 GTTACTGTGCACTGGGGAAAGGG - Intergenic
1108914481 13:55590274-55590296 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1109516093 13:63443928-63443950 GTAACTGTGCACTGGAGAAAGGG + Intergenic
1109849783 13:68046828-68046850 GTAACTGTGTATTGCACAAAAGG + Intergenic
1109905527 13:68835349-68835371 GTAGCTGTGCATTTGGGATAGGG - Intergenic
1109951207 13:69503598-69503620 GTAACTGTGCATTGGTGAAAGGG - Intergenic
1110376997 13:74805106-74805128 GTAACTGTGCACTGGGGATAGGG + Intergenic
1111057966 13:82974338-82974360 GTAACTGTGCACTGCGGAAAGGG - Intergenic
1111432395 13:88160989-88161011 GTAACTGTGCATTGAAAAAAGGG - Intergenic
1111524172 13:89446691-89446713 TTATTTGTTCATTGGGGAAATGG - Intergenic
1111557059 13:89894426-89894448 GTAACTATACACTGAGGAAAAGG - Intergenic
1111575933 13:90154149-90154171 GTAACTGTGCATTGGAGAAAGGG - Intergenic
1111779511 13:92703729-92703751 GTTACTGTTAATTGGGGGAAGGG + Intronic
1112248565 13:97756798-97756820 TTAACTCAGCTTTGGGGAAAGGG - Intergenic
1112250112 13:97771615-97771637 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1113007352 13:105722239-105722261 GTAACTGTGCTTAGGGGCCATGG - Intergenic
1113319894 13:109223048-109223070 GTAACTGTGGATTAGGGAAAGGG - Intergenic
1113396013 13:109948473-109948495 GTAACTGTGCATTGGGAAAAGGG + Intergenic
1114441083 14:22748463-22748485 GTGACTCTGCATTGAGAAAATGG + Intergenic
1114758445 14:25285246-25285268 GTAACTGAGCACTGGGGAAGGGG - Intergenic
1114883093 14:26811286-26811308 GTTACTTTTCATTGGGGAAAAGG + Intergenic
1114905563 14:27121837-27121859 GTAACTGTGCACTGGAGAAAGGG - Intergenic
1115530056 14:34318855-34318877 GTCACTGTGCACTGAAGAAAAGG - Intronic
1116058722 14:39895555-39895577 GTAACTGTGCATTGGAGAAAGGG + Intergenic
1116067901 14:40007795-40007817 GTAACTGTGTATTGGAGAAAGGG + Intergenic
1116175898 14:41469893-41469915 GTGACTGTGCACTGCAGAAAGGG - Intergenic
1116218507 14:42052335-42052357 GTAACTGTGCATTGGGGAAAAGG + Intergenic
1116248975 14:42456899-42456921 GTAACTGTGCATTGGGAAAAAGG + Intergenic
1116639584 14:47443937-47443959 GTAACTGTGTTTTGGCAAAAAGG - Intronic
1116791490 14:49344764-49344786 GTAACCATACATTGGAGAAAGGG + Intergenic
1116937153 14:50752569-50752591 GAAACAGTGCATTGGAGGAACGG - Exonic
1117001398 14:51374912-51374934 GTGTCTGTGCACTGGGGAAAGGG + Intergenic
1117146438 14:52840913-52840935 GAAACTTTGCTTTGGGGACAAGG + Intergenic
1117216643 14:53558719-53558741 GTAACTGTGCAATGGGGAAAGGG + Intergenic
1117292026 14:54343646-54343668 TTAACGGTACTTTGGGGAAAGGG - Intergenic
1117596458 14:57331263-57331285 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1117633939 14:57723012-57723034 GTAACTGTGCACTGGGGAAAAGG + Intronic
1118880950 14:69825388-69825410 GTAACTGTGCATTGGAGAAAGGG - Intergenic
1118950744 14:70434451-70434473 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1119059879 14:71463523-71463545 GTAACTGTGCACTGGGGAAAGGG - Intronic
1119874588 14:78046939-78046961 GTAACTATGCATAGTTGAAAAGG + Intergenic
1120082212 14:80228917-80228939 GTAGCTGTGCATTGGAGAAAGGG - Intronic
1120231602 14:81846637-81846659 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1120556177 14:85931815-85931837 GTAATTGTGCATTGGGGAAAGGG - Intergenic
1120973480 14:90229083-90229105 GTAACTGTGCATTAGGGAAAGGG + Intergenic
1121371195 14:93359912-93359934 GTAACTGTGCACTGGGGAAAGGG + Intronic
1122841593 14:104467171-104467193 GTGACTGTGCACTGGGGAAAAGG - Intergenic
1124844822 15:33279966-33279988 GCCACTGTGAGTTGGGGAAAAGG - Intergenic
1125205727 15:37151764-37151786 GTAACTGTTTACTGGGGAAGGGG + Intergenic
1125783412 15:42292031-42292053 GACACTGTGCACTGGAGAAAGGG + Intronic
1126906069 15:53367191-53367213 GTGACTGTGCATTGAGGAAAGGG - Intergenic
1127356720 15:58207806-58207828 GTAACTGTGCATTGGGGAAAGGG + Intronic
1127469602 15:59278716-59278738 GAAACAGTGCATGGGGGACAGGG + Intronic
1127688007 15:61367432-61367454 GTGATTGTGAATTGGGGAAGGGG + Intergenic
1128621781 15:69157448-69157470 GAAATTGAGCATTGGAGAAAAGG + Intergenic
1128760942 15:70215546-70215568 CTACCTGGGCAGTGGGGAAAGGG + Intergenic
1129961521 15:79691120-79691142 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1131935408 15:97498891-97498913 GTAACTATGCTTTGGGAAAGGGG - Intergenic
1134647763 16:15883947-15883969 GTTTCTGAGAATTGGGGAAAGGG + Intronic
1134784001 16:16924437-16924459 GTGACTATGCATTAGGAAAAAGG - Intergenic
1135061853 16:19277855-19277877 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1135625842 16:23994116-23994138 ATAACTGTGCACTAGAGAAAAGG + Intronic
1136529522 16:30858381-30858403 GTGTCTGTGCCTTGGGGAGAGGG + Intronic
1137653053 16:50136739-50136761 GTAGTTGTGCATTGGGAAGAAGG - Intergenic
1137988383 16:53130070-53130092 GTAACTGTGCAATGGAGAACGGG + Intronic
1138868208 16:60849407-60849429 TTAACTGTGCATTGGGGAAAGGG + Intergenic
1140394298 16:74613906-74613928 GTGACTGTACATTGGCAAAAGGG - Intergenic
1140454262 16:75095700-75095722 GTAACTCTGCATTTGGGCCATGG - Intronic
1141559730 16:84859412-84859434 GAAACCGTGCACTGGGGAAAGGG - Intronic
1142945789 17:3425998-3426020 GTAACTGTGCATTGGGGAAAGGG - Intergenic
1143704908 17:8690407-8690429 GTAACTGAGTAGGGGGGAAAAGG - Intergenic
1143871156 17:9958107-9958129 ATAACTGTCAAGTGGGGAAATGG - Intronic
1143997472 17:11019710-11019732 GTAGCAGTGCAATGGGGCAATGG - Intergenic
1145017854 17:19410822-19410844 GTAACTGTTCATTGGATGAATGG + Intergenic
1146003603 17:29147019-29147041 GGAATTGTGGAATGGGGAAACGG + Intronic
1146740940 17:35282981-35283003 GTGACTCTGTACTGGGGAAATGG + Intergenic
1147708854 17:42448352-42448374 GTGACTGTACATTGGAGACAGGG - Intergenic
1147815081 17:43203866-43203888 GTAACATGGCATTGTGGAAAGGG + Intronic
1149236184 17:54593627-54593649 ATAACTGTGCACTGGGAAGAGGG - Intergenic
1149426925 17:56564219-56564241 GTAACTGTGCACTGGGGGAAAGG + Intergenic
1153131461 18:1859102-1859124 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1153217885 18:2836992-2837014 GTGACTGTGCATTGCAGAAAGGG - Intergenic
1153745514 18:8174901-8174923 GTCCCTGTGCTTTGGAGAAAAGG + Intronic
1153955782 18:10094924-10094946 GTAACTGTGCATTGAGGAAAGGG + Intergenic
1154068282 18:11129714-11129736 GTAACTGTGCATTGAGGAAAGGG + Intronic
1154252918 18:12758982-12759004 GTAACTGTGCATTGGGGAAAGGG - Intergenic
1154367174 18:13721873-13721895 GTAAGTGTGCACTGGAGAAGAGG - Intronic
1154506004 18:15041483-15041505 GTAACTGTGCATTGATGAAAGGG + Intergenic
1155171869 18:23272804-23272826 GACACTGTGCATTGAGGAATTGG - Intronic
1155244861 18:23897712-23897734 TTAACTTTACTTTGGGGAAAGGG - Intronic
1155488367 18:26371920-26371942 GTGATTGTGCACTGGGGAAGGGG + Intronic
1155741942 18:29299375-29299397 GTAACTGTGCATTGGGGAAAGGG - Intergenic
1155822583 18:30397184-30397206 GTAATGGTGCACTGAGGAAAAGG - Intergenic
1156192231 18:34733089-34733111 GTAACTGTGCACTGGGGAAAGGG - Intronic
1156303684 18:35857347-35857369 GTAAATGTGCATTGGGGAAAAGG + Intergenic
1156367457 18:36442167-36442189 GAAACAGAGCAATGGGGAAAGGG - Intronic
1156395789 18:36698821-36698843 GGAACTGAGGCTTGGGGAAATGG - Intronic
1156537605 18:37879147-37879169 GTAACTGTGCACTGGGGAAAGGG + Intergenic
1156990471 18:43402077-43402099 ATAACTGTGCACTGGGGAGAGGG - Intergenic
1156998416 18:43496337-43496359 ATAACTATGCACTGGGGAAAGGG + Intergenic
1157062839 18:44312838-44312860 ATCACTGTTCATTGGAGAAATGG - Intergenic
1158395408 18:57075482-57075504 GCATGTGGGCATTGGGGAAAGGG + Intergenic
1158632811 18:59131179-59131201 GTGACTATACACTGGGGAAAAGG - Intergenic
1158639494 18:59191410-59191432 AGAACAGTGCATTGGGTAAAGGG - Intergenic
1159028628 18:63209052-63209074 GTGACTGTGCACTGGGGAAAAGG - Intronic
1159232448 18:65627061-65627083 GGAGCTGTGCACTGAGGAAATGG + Intergenic
1159287609 18:66374092-66374114 GTAACTGTGCACTTGGGAAAGGG + Intergenic
1159524857 18:69575138-69575160 CTGACTGTGTATAGGGGAAATGG + Intronic
1160374915 18:78404474-78404496 ATATCTGTGCATGGTGGAAAGGG - Intergenic
1164097303 19:22023053-22023075 GTTATTGTGCACTGGGGAAAGGG - Intergenic
1164117495 19:22236489-22236511 GTAACTGTGCATTGGGGAAAGGG - Intergenic
1164200194 19:23011768-23011790 GTAACAGTGCACTGGGAAAAGGG - Intergenic
1165810398 19:38608302-38608324 GGAACTGTCCCTTGGGGAAAGGG + Intronic
1166159782 19:40943771-40943793 GTACCTGTGCATGTGGGAAGAGG + Intergenic
1168539541 19:57198751-57198773 GTAACTGTGCACTGGGGAAAGGG - Intronic
925460540 2:4059085-4059107 GTAACTGTACACTGGGGAAGGGG + Intergenic
926342072 2:11911803-11911825 GTGACTATGCATTGGAGGAAAGG - Intergenic
926810574 2:16752055-16752077 GTAACCGTGCAATGGGTAAAGGG - Intergenic
926826595 2:16912307-16912329 GTAACTGTGCACTGGGGAAAGGG + Intergenic
926976816 2:18523757-18523779 GTAACTCTGGATTGGAGAACAGG - Intergenic
929270015 2:39962153-39962175 GTAACTGTGCACTGGGGAAAGGG - Intergenic
929530046 2:42744538-42744560 GTCACTGAGAATGGGGGAAAGGG - Intronic
930456442 2:51613146-51613168 GTAACTGTGTATTGGAAAAAGGG - Intergenic
930536783 2:52653636-52653658 TTAACTGTGCATTAGGGATAGGG - Intergenic
930852352 2:55974508-55974530 GGAACTGTGAATTTGGGAAAAGG - Intergenic
932975606 2:76596632-76596654 GTAACTGCGCATTGAGGAAAGGG + Intergenic
933265903 2:80180100-80180122 GTAACTGTGCACTGGGGAAAGGG - Intronic
935441674 2:103105161-103105183 GAAACTGTGTCTTTGGGAAACGG - Intergenic
935564500 2:104591645-104591667 GTATCTGTGCACTGGGGAAAGGG - Intergenic
935578534 2:104735659-104735681 AGAACTGTGCATGGGGGTAAAGG + Intergenic
935823060 2:106913840-106913862 GTAACAGTGCATTGGCGAAAAGG + Intergenic
936109434 2:109652891-109652913 TTGACTGTGCATCTGGGAAAGGG - Intergenic
936447153 2:112605341-112605363 GTAAATGTACACTGGGGAAAAGG - Intergenic
936614174 2:114031989-114032011 GTTACTGTGCACTGAGGAAATGG + Intergenic
937785379 2:125889095-125889117 GCAACTGTGCACTGGGGAAAGGG - Intergenic
937800150 2:126073362-126073384 GAAACTGTGAATTGGGGAAAGGG + Intergenic
937852748 2:126650107-126650129 GTAACTGTGCACTGGGGAAAGGG - Intergenic
937866976 2:126759755-126759777 GTGACTGTGAATTGGGGGAAAGG + Intergenic
938203764 2:129399697-129399719 GCAACTGTGCATTCTGGAACTGG - Intergenic
939213641 2:139210536-139210558 GTAACTGTACACTGGGGAAAGGG + Intergenic
939341948 2:140907913-140907935 GAAACTCTGCAATGGGAAAAAGG - Exonic
939788856 2:146547459-146547481 GTAACTGTGCACTGGGGAAAGGG - Intergenic
939806065 2:146777100-146777122 GTAAGTGTGCTTTGGGGAAAGGG + Intergenic
939903229 2:147876935-147876957 GTATCTGTGCAATGAGGACATGG - Intronic
940171501 2:150834103-150834125 GTAGCTGTGCACTGGGGAAAGGG - Intergenic
941462001 2:165782744-165782766 GAGACTATGCTTTGGGGAAAAGG - Intronic
941667827 2:168259803-168259825 GTAACTGTGCATTGCGGAAAGGG + Intergenic
941748515 2:169111797-169111819 GTGAGTGTGGATTGGGGACATGG - Intergenic
941838310 2:170050922-170050944 GTATCTGTGCATTTTGGAATTGG - Intronic
943029206 2:182666895-182666917 GTGACTGTGTACTGGGAAAAAGG - Intergenic
943239388 2:185363970-185363992 GTAACTGTGTACTGAGGAAAGGG - Intergenic
943318028 2:186413034-186413056 TTAACTGTGCAATGGGGAAAGGG - Intergenic
943384209 2:187182251-187182273 GTAACTGTGCATTGGAGACAGGG - Intergenic
943387961 2:187225752-187225774 GTAACTGTGCACTGGGGAAAGGG + Intergenic
943517780 2:188908617-188908639 GTAACTGTGCAGTGGGGAAAGGG - Intergenic
944119344 2:196224211-196224233 GTAACTGGGCATATGGGAGAAGG + Intronic
944625954 2:201569080-201569102 GTATTTGTGCACTGGGGAGAAGG - Intronic
945641983 2:212442445-212442467 GTAACTGTGCACAGGGGAAAGGG + Intronic
945726010 2:213472863-213472885 GTAACTGTGCATTGGAGGAAGGG - Intronic
945940182 2:215941513-215941535 ATAACTGTACACTGGGGAAGGGG - Intergenic
946528048 2:220541355-220541377 GTAACTGTGCATTGGGGAAAGGG - Intergenic
946703969 2:222439167-222439189 GTAACTGTGCACTGGGGAAAGGG - Intronic
946740893 2:222800250-222800272 GAAGCTCTGCATTGGGGAGAGGG - Intergenic
946756663 2:222954006-222954028 CTACCTCTGCACTGGGGAAATGG + Intergenic
946873699 2:224107695-224107717 GTAACTGTCCACTAGGGAAAAGG - Intergenic
947874065 2:233457076-233457098 GTCCCTGTGCATGGAGGAAATGG - Intronic
948369392 2:237478405-237478427 ATAACTGTACATAGGGGAAAGGG - Intergenic
1168917410 20:1501420-1501442 ATTTCTGTGCACTGGGGAAAGGG - Intergenic
1169208421 20:3752723-3752745 ATGACTGTGAATTGTGGAAAGGG + Exonic
1169252516 20:4071502-4071524 GCAGCTTTGCAGTGGGGAAAGGG + Intronic
1169611256 20:7382486-7382508 ATAACTGTGCATTAAGAAAACGG - Intergenic
1169736005 20:8838287-8838309 GTGACTATGCATTGGAGAAAAGG + Intronic
1170092466 20:12605483-12605505 GTAACTGTGCATTGGGGAAAAGG - Intergenic
1170298848 20:14859723-14859745 GAAACTATGCATTGGAAAAATGG - Intronic
1170350654 20:15437389-15437411 GTGTGTGTGCATTGGGGAAGAGG - Intronic
1170671571 20:18439211-18439233 GTGACTGTGCAGTGGGGAAAAGG - Intronic
1170956257 20:20982583-20982605 GCAACTGTGCACTAGGAAAAAGG - Intergenic
1171410005 20:24940019-24940041 GTTACTGTGCATTGGGAAAAAGG - Intergenic
1173004301 20:39127732-39127754 CTCACTGTGCACTGGGGAGAGGG - Intergenic
1173406802 20:42773452-42773474 GTAAAAGTACATTGGGGAAATGG - Intronic
1173709312 20:45140624-45140646 GGAACTGTGTACTGGGGAAAGGG - Intergenic
1173765377 20:45603271-45603293 AAAACTGTACATTGGGGAAAGGG - Intergenic
1175080692 20:56418036-56418058 ATAACTATGCATTGGGTGAATGG - Intronic
1176791850 21:13327543-13327565 GTAACTGTGCATTGATGAAAGGG - Intergenic
1177002795 21:15634921-15634943 GTAACTGTGCGCTGGGGAAAGGG - Intergenic
1177363554 21:20104475-20104497 GTAACTGTGCACTGGAGAAAGGG + Intergenic
1177505796 21:22015900-22015922 GTAACTGTGCAATGGGGAAAGGG - Intergenic
1177991243 21:28038545-28038567 GCAACTGTGCATTGATGAAAGGG - Intergenic
1178060933 21:28852525-28852547 GCAACTGTGGATTGGGGAAATGG - Intergenic
1178764000 21:35432310-35432332 TTAACTGTTCACTGGGAAAAGGG - Intronic
1179045438 21:37840379-37840401 GTAACACTGCATTGGGGATTGGG - Intronic
1179383349 21:40919692-40919714 ATGACTGTGCATTGTGGGAAAGG + Intergenic
1179415344 21:41193904-41193926 GTAACTGTGCACTGGGGAAAGGG - Intronic
1179458379 21:41515496-41515518 GTGACTGTGCATTGTGGGAAAGG - Intronic
1180591322 22:16939748-16939770 GTAACTGTGCATTGGGGAAAGGG - Intergenic
1180873480 22:19161956-19161978 GTAGCTGTGCGCTGGGGAAAGGG - Intergenic
1183819241 22:40331728-40331750 GTAACTATGCATTCTGCAAAGGG + Exonic
1184638898 22:45858399-45858421 GTAACTGTGCACTGAGGAAAAGG - Intergenic
949125850 3:444534-444556 GTAACTGTGCATTGGGGAAAGGG - Intergenic
949170223 3:987979-988001 GTAACTGTGCATTGGGGAAAGGG - Intergenic
949751161 3:7354190-7354212 ATAACTGTGTACTGGGGAAAAGG + Intronic
950575674 3:13830711-13830733 GAAAGTGTGGCTTGGGGAAAAGG - Intronic
951122406 3:18944188-18944210 ATTACTGTGCACTGAGGAAATGG + Intergenic
951423628 3:22517114-22517136 TTAACTGTGCATTGGGGAAAGGG + Intergenic
951535283 3:23735074-23735096 CTAAATGTGCAATAGGGAAAAGG - Intergenic
951851080 3:27140418-27140440 GTGACTGTTTACTGGGGAAAAGG + Intronic
953897572 3:46813876-46813898 GTAACTGTGCACTGGGGAAAGGG - Intergenic
955610972 3:60756925-60756947 GAAACTATGGACTGGGGAAAGGG + Intronic
955630742 3:60971543-60971565 CTATCTATGCATTGGAGAAAGGG + Intronic
955962724 3:64357585-64357607 GTAAATGTGCATTTGGGATGTGG - Intronic
956086745 3:65619561-65619583 GTAACTGTGCTGCAGGGAAATGG - Intronic
956260599 3:67336195-67336217 GTAACAGTCCACTGGGGAAGGGG - Intergenic
956509467 3:69978975-69978997 GTAACTGTGCATTGGGGAAAGGG + Intergenic
957247715 3:77734709-77734731 GTAACTGTGTGTTGGGGAAAGGG - Intergenic
957593465 3:82229532-82229554 GCAGCTGTGCTTAGGGGAAAAGG - Intergenic
957634262 3:82760751-82760773 GTAACTGTGCACTGGGGAAAAGG + Intergenic
957874457 3:86127953-86127975 GTAGCTATGTACTGGGGAAAAGG + Intergenic
958036324 3:88174007-88174029 GTAACTGTGCATTGGTAAAAAGG + Intergenic
958789017 3:98629969-98629991 GTAACTGTGCATTGGGAAAAGGG - Intergenic
958845710 3:99261895-99261917 GTAACTGTGTATTGGGGAAAGGG - Intergenic
958934125 3:100239249-100239271 GTAACTATGTATTGGGGAAAGGG + Intergenic
959189959 3:103098203-103098225 GAATCTGTGCATTTGGGAGAGGG - Intergenic
959226953 3:103598654-103598676 GTAACTGTGCATTGGGGAAAGGG - Intergenic
959578748 3:107962828-107962850 GTAACAATGTACTGGGGAAAGGG - Intergenic
959671246 3:108980146-108980168 GTAAGTGGGGAATGGGGAAATGG - Intronic
960210707 3:114962152-114962174 GCAACTGTGCATGTGGAAAAGGG - Intronic
960494921 3:118362167-118362189 GTAACTGTGTACTGGGGAAAGGG - Intergenic
960768215 3:121162303-121162325 AAAAATGTGCAATGGGGAAAGGG + Intronic
961979918 3:131066347-131066369 GTACATGTGCCTTGGGGACAGGG + Intronic
962214697 3:133511192-133511214 GTAACTGTGCATTGGGGAAAAGG + Intergenic
963391918 3:144675463-144675485 CTAACAGTACAATGGGGAAAGGG + Intergenic
963566727 3:146939592-146939614 GTAACTGTGCATTGTGGAACAGG + Intergenic
963630131 3:147721844-147721866 GTAACTGTGCATTGGGAAAAGGG + Intergenic
963661212 3:148130757-148130779 GTAACTATGCACTGGGGAAAGGG + Intergenic
963734495 3:149004528-149004550 TGAACTGTGCATTTGGGAAAAGG + Intronic
964021674 3:152021057-152021079 GAATCTGTGCACTTGGGAAAGGG + Intergenic
964977381 3:162637162-162637184 GTAACTGTGCATTGGGGAAAGGG - Intergenic
965226938 3:166002150-166002172 GTAACTCTGTATTGGGGAAAGGG - Intergenic
965496865 3:169409369-169409391 GTAACTCTCCTTTGGGAAAATGG - Intronic
965619138 3:170625047-170625069 GTTACTGTGCATAGGGCAAGGGG - Intronic
965697784 3:171427461-171427483 GAAACTGAGCATTGGGCACATGG - Intronic
966445501 3:179997182-179997204 GTAACTGTGCACTGGGGAAAGGG + Intronic
966628035 3:182040096-182040118 GTCACTGTGTATTGAGAAAAAGG + Intergenic
966687498 3:182711890-182711912 GAAACTGTGTGTTGGGGAGATGG - Intergenic
966763323 3:183436289-183436311 GTAGCTATACATTAGGGAAAAGG + Intergenic
967571019 3:191028401-191028423 GTAACTGAACATTGGGGTAAAGG - Intergenic
967933940 3:194711501-194711523 GTAACTCATCATTTGGGAAAGGG + Intergenic
969860166 4:10029315-10029337 GAGACTGTGCATCGGGGATAGGG - Intronic
970941498 4:21639990-21640012 GTGACTGTGTTTTAGGGAAAAGG - Intronic
971101204 4:23467808-23467830 GTAACTGTTCATTGGGGAAAAGG - Intergenic
971817045 4:31503683-31503705 GTAACGGTGCATTGGGAAAAGGG + Intergenic
971979467 4:33734243-33734265 GTAACTGTGCATTGGGGAAAGGG - Intergenic
972085054 4:35205702-35205724 GTAACTGTGCGCTGGGGAAAGGG + Intergenic
972805706 4:42527964-42527986 GTAACTTTGCACTGGGGAAAGGG + Intronic
972883151 4:43449537-43449559 GTAACTGTGCATTGGGGGAAGGG - Intergenic
973118261 4:46487662-46487684 GTAAGTGTGCATTGGGGAAAGGG + Intergenic
973143530 4:46797232-46797254 ATAACTGTACACTGGGGAAAAGG + Intronic
974231791 4:59125895-59125917 ATGATTGTGCATTGGGAAAAAGG - Intergenic
974262553 4:59543661-59543683 GTAACTGTGCACTGGGGAAAGGG - Intergenic
974410833 4:61539305-61539327 GTAACAGTGGGTTGGGGAACAGG + Intronic
974747091 4:66090304-66090326 GTAACTGTGCACTGGGGAAAGGG - Intergenic
975731881 4:77345478-77345500 GCTTCTGTGTATTGGGGAAAGGG + Intronic
975982801 4:80178657-80178679 GTAACTGTGCACTGGGGAAAGGG - Intergenic
976034367 4:80797145-80797167 GTAACTGTGCATTGGTGAAAGGG - Intronic
976374238 4:84325845-84325867 GTAATTGAGCTTTGTGGAAAAGG + Intergenic
977204510 4:94154237-94154259 GTAACTGTGCACTGGGAAAAGGG + Intergenic
977430579 4:96926840-96926862 GTAACTGTGCATTGGGAACAGGG + Intergenic
977465811 4:97382006-97382028 GTAATTGTGGCTTGGGGAAAGGG + Intronic
977490264 4:97701451-97701473 TTAACTGTGCATTGGGGAAAGGG - Intronic
977833452 4:101619559-101619581 GTGACTATGCATTGGGGAAAGGG - Intronic
977976893 4:103276488-103276510 GTAACTGTTCATTGAGGAAAGGG - Intergenic
978341836 4:107727643-107727665 GTAATTGTGCATTGGGGAAAGGG - Intergenic
978899256 4:113928221-113928243 GTAACTGAGCATTGGGGAAAGGG - Intronic
978966674 4:114749557-114749579 GTAACTGCACACTGGGGAAAGGG + Intergenic
979017891 4:115458293-115458315 ATAACTGTGCACTGGGGAAAGGG - Intergenic
979048080 4:115895202-115895224 ATAATTGTGCATTGGGGAAAAGG + Intergenic
979075031 4:116260322-116260344 GTAATTGTGTATTGGAGAAGGGG + Intergenic
979075535 4:116265024-116265046 GTAACTGTGCACTGGGGAAACGG + Intergenic
979121331 4:116905598-116905620 GGTACTGTGCATTGGGGGCAGGG - Intergenic
979766828 4:124473205-124473227 GTAACTGTACACTGGGGAAAGGG + Intergenic
979888726 4:126063530-126063552 GTAACTGTGCATTGGTGAAAGGG - Intergenic
980386435 4:132091873-132091895 GTAACTGTGCATTGGGGAAAGGG - Intergenic
980406070 4:132355183-132355205 GTAACTGTGCACTGGGGATAGGG - Intergenic
980497718 4:133606757-133606779 TTAACTGTGCACTGGGGACAGGG - Intergenic
980582411 4:134772176-134772198 TTAACTGTACATTGGGAAAAGGG - Intergenic
980601981 4:135038091-135038113 GTAATTGTGCATTGGGGAATGGG + Intergenic
980629364 4:135412889-135412911 GTGACTGTGCATTGGGGAAAGGG + Intergenic
980691798 4:136305043-136305065 GTGACTGTGCAATGGGGAAAGGG - Intergenic
980692418 4:136312378-136312400 GTCACTGTTCACTGGGGAAAAGG + Intergenic
980957552 4:139444544-139444566 AAAACTGTGCACTGGGGAAAGGG + Intergenic
981160783 4:141496185-141496207 GTGACTGTGCACTGTGGAAAAGG + Intergenic
981834809 4:149042555-149042577 GTAACTGTGCACTGGGGAAAGGG + Intergenic
981979497 4:150773945-150773967 GTTACTGTTCACTGGGGAAAAGG - Intronic
982303784 4:153907260-153907282 GTAACTCTGAACTAGGGAAAGGG - Intergenic
982466823 4:155742396-155742418 GTAGTTGTGCAATGGGGAAAAGG - Intergenic
982527023 4:156491022-156491044 GTAACTGTGCATTGGGGAAAGGG + Intergenic
982835349 4:160115260-160115282 GTAACTGTGCACTGGGGAAAGGG + Intergenic
982851166 4:160317899-160317921 GTAATTGTACATTGGGGAAAAGG - Intergenic
982887099 4:160795417-160795439 CTAACTGTAAATTGAGGAAAGGG + Intergenic
983184879 4:164690187-164690209 GTAACTGTGTAATGGAGAAAAGG + Intergenic
983359219 4:166706729-166706751 GTAACTGTGCATTGAGGAAAGGG + Intergenic
983495131 4:168434987-168435009 GTAACTGTCCACTGGAGAAGGGG + Intronic
984055548 4:174924883-174924905 GTAACTTTACATTAGAGAAATGG + Intronic
984273276 4:177574339-177574361 GTAACTGAACATGAGGGAAAAGG - Intergenic
984414020 4:179434070-179434092 GTGACTGTGCACTGTGGAAGGGG - Intergenic
984791784 4:183621642-183621664 GTAACTTTACAGTGGAGAAACGG + Intergenic
986091648 5:4514045-4514067 GTGTGTGTCCATTGGGGAAAAGG - Intergenic
986742734 5:10718116-10718138 GTAACTGTGGATTGGGGAAAGGG + Intronic
986937251 5:12904724-12904746 GTAACTGTGCACTGGGGAAAGGG + Intergenic
986938503 5:12920123-12920145 GTAACTGTGCACTGGGGAAAGGG - Intergenic
986959646 5:13197813-13197835 GTATCTGTGCAATGGGCAAAGGG + Intergenic
987152995 5:15060283-15060305 GTAACTGTGCCCTGGGGAAAGGG + Intergenic
987284031 5:16438368-16438390 GTAACTGTTCAATGGGAAAAAGG - Intergenic
987504220 5:18748479-18748501 GTAGCTGTGCAATGGGGAAAGGG + Intergenic
987657299 5:20823024-20823046 GTAACTGTGCTTTGGAGAAGGGG - Intergenic
988039181 5:25866251-25866273 GTAGCTGTGCAGTTGAGAAATGG - Intergenic
988080005 5:26402806-26402828 GTAACTGTGCACTGGGGAAAGGG - Intergenic
988092426 5:26561215-26561237 GTAACTGTGCACTCGAAAAAGGG + Intergenic
988107580 5:26771139-26771161 GTAACTGTGCACTGGGGAAAGGG + Intergenic
988169367 5:27634193-27634215 GTAATTGTGCACTGGGGAAAGGG - Intergenic
988188602 5:27899871-27899893 GTAACTGTGCACTGGGGAAAGGG + Intergenic
988228597 5:28446769-28446791 GTCACTGTGCACTGGGGAAAGGG + Intergenic
988233457 5:28508460-28508482 GTAACTGTGCACTGGGGAAAGGG - Intergenic
988267675 5:28972741-28972763 GTAACTGTGCATTGGGGAAAGGG - Intergenic
988275715 5:29079160-29079182 GTGACTGTGCATTGGGGAAAGGG - Intergenic
988561946 5:32289498-32289520 GTAAGTGTGCACTGGGGAAAGGG + Intronic
988766247 5:34380924-34380946 GTAACTGTGCTTTGGAGAAGGGG + Intergenic
988971486 5:36472752-36472774 GCTACTGTGCATTTGGGATAGGG + Intergenic
988995478 5:36710962-36710984 TCAACTGTGCATTGGGAAAAGGG - Intergenic
989045407 5:37268981-37269003 GTAACTGTGCATCAGGGAAAGGG - Intergenic
989307669 5:39975942-39975964 GTAACTGTGCACTGGGGACAGGG - Intergenic
989332579 5:40277222-40277244 TTAACTGTGCATTTAGGCAAGGG - Intergenic
989457829 5:41663154-41663176 GTAACTGTGCACTAGGGAAAGGG - Intergenic
989486559 5:41997757-41997779 GTAATTGCACACTGGGGAAAGGG - Intergenic
990220573 5:53584071-53584093 ATAACTGTGCATTGGGGAGTGGG - Intronic
990454932 5:55975774-55975796 GTAACTGTAATTTGGGGACAAGG + Intronic
991013999 5:61912290-61912312 GTCACTGTGCTTTAGGGAAAGGG - Intergenic
991501259 5:67279567-67279589 GGAACTGTGTACTGGAGAAATGG - Intergenic
991945964 5:71898749-71898771 GTAACTGTGCACTGGAGAAAGGG + Intergenic
992242689 5:74788054-74788076 GTAACTGTGCACTGGGGAAAGGG + Intronic
993205671 5:84875453-84875475 GTATCTGTGCATTTAGGGAAGGG + Intergenic
993232084 5:85248927-85248949 GTAACTGTACCCTGGGGAAAGGG - Intergenic
993412755 5:87593196-87593218 GTAACTGTGCATTGGAGAAAGGG - Intergenic
993780525 5:92061007-92061029 GTAACTGTGCACTGGGGAAAGGG + Intergenic
994291553 5:98033354-98033376 GGTACTTTGCACTGGGGAAAGGG - Intergenic
994539374 5:101075523-101075545 GTAACTGTGCTTCGAAGAAAAGG + Intergenic
994587475 5:101728097-101728119 GTGTCTGTGCATAGGGGAAGGGG - Intergenic
994958282 5:106562947-106562969 GTAACTGTGCACTGGGGAAAGGG + Intergenic
994974006 5:106779316-106779338 AAATCTGTGCATTTGGGAAAAGG + Intergenic
994984596 5:106917105-106917127 GTAACTATGCACTGGGGAAAGGG - Intergenic
995275977 5:110278257-110278279 GTATCTGTGCATTTGGGTATGGG + Intergenic
995427921 5:112045113-112045135 GTAACTGTGCACTGGGGAAAGGG - Intergenic
995776467 5:115729058-115729080 GCAACTGTGCACTGGGGAAAGGG - Intergenic
995916485 5:117251792-117251814 GTAACTCTTAATTTGGGAAAAGG - Intergenic
996165132 5:120213906-120213928 GTAACTGTGCACTGGGGAAAAGG - Intergenic
996488791 5:124067944-124067966 GTGACTGTTCACTGGGAAAAAGG - Intergenic
996602277 5:125278211-125278233 ACAACTGTGCATTGAAGAAATGG + Intergenic
996825380 5:127676445-127676467 GTAACTGTGCATTGGGAAAAGGG + Intergenic
996908871 5:128633405-128633427 GTAACTGTGCATTAGGGAAAGGG - Intronic
997192311 5:131948530-131948552 GAAGCAGTGCAATGGGGAAATGG - Intronic
997601632 5:135142624-135142646 GCAGCTGTGCTTTGGGGAAGGGG - Intronic
999351209 5:150873470-150873492 ATAACTATGCACTGGGGAAAGGG + Intronic
1000223432 5:159235661-159235683 GTAGCTGTGCACTGGGGAAAGGG - Intergenic
1000621765 5:163494269-163494291 GTAACTGTGCATTAGAAAAAGGG - Intergenic
1000871116 5:166578811-166578833 ATAACTGTGTACTGGGGAAGGGG - Intergenic
1000901444 5:166916485-166916507 GCACCTATGCATTGGGGCAAAGG - Intergenic
1001965117 5:175904544-175904566 ATAACTGTGTACTGGGGAAGGGG + Intergenic
1002251835 5:177934644-177934666 GTAACTGTGTACTGGGGAAGGGG - Intergenic
1002493017 5:179592977-179592999 TTAACCGTGCAGTGAGGAAAAGG + Intronic
1002683009 5:180982783-180982805 TTAACAGTGCACTGGGGAAGAGG + Intergenic
1002997783 6:2303359-2303381 GTAACTGTGCACTGGGGAAAGGG + Intergenic
1003442842 6:6159490-6159512 GCAACTGTGCAAAGTGGAAAAGG + Intronic
1003470091 6:6421442-6421464 GTAAATGTGCACTGGAGAAAAGG - Intergenic
1003696087 6:8407528-8407550 GTAACTGTGCACTGGGGAAAAGG - Intergenic
1004298431 6:14435311-14435333 GTAAATGTGCCTTGAGGAAAAGG + Intergenic
1004824477 6:19404617-19404639 GTAACTGTGCATTGGGGAAAGGG - Intergenic
1005577918 6:27207333-27207355 GTGACTGTGCTTTGGGAAAGGGG + Intergenic
1006001327 6:30967378-30967400 GTAACTGTGTATTGGGGAAAGGG + Intergenic
1006422506 6:33944173-33944195 GTAACTCTTCTTTGAGGAAACGG + Intergenic
1007235365 6:40387439-40387461 GTTACTTTGCATTTGGGAAGGGG + Intergenic
1007238319 6:40406829-40406851 GAAACTGTGCTATGAGGAAATGG - Intronic
1007285225 6:40742784-40742806 GTGAGTGTGCATTGGGGAAGGGG - Intergenic
1008400109 6:51054110-51054132 GTAACTGTTCACTGGGGAAAGGG + Intergenic
1008820257 6:55624078-55624100 GTAAGCATGCACTGGGGAAAAGG - Intergenic
1009390294 6:63136464-63136486 GTAACTGTGCATTGGGAAAAGGG - Intergenic
1009563013 6:65273345-65273367 GTAACTCTGCATTAAGGGAAGGG + Intronic
1009787169 6:68354878-68354900 GTAACTGTGCATTGAGGAAAGGG - Intergenic
1009806315 6:68605565-68605587 GTAACTGTGCACTGGGAAAAGGG + Intergenic
1010561800 6:77360077-77360099 ATAACTGTGGACTGGGTAAAAGG + Intergenic
1010580906 6:77595121-77595143 GTAACTGTGTACTGGAGAAAAGG - Intergenic
1010592757 6:77729832-77729854 GAAACAATGCATTGGGTAAAAGG + Intronic
1010818443 6:80387016-80387038 GTAACTGTGCATTGGGTAAAGGG + Intergenic
1011039537 6:83014665-83014687 CTAACTGTTCACTGGGGATAGGG - Intronic
1011068916 6:83360284-83360306 GTAACTGTGCACTGGGGAAAGGG + Intronic
1011305171 6:85917600-85917622 TTGACTGTGCATTGGGGAAAGGG + Intergenic
1011331020 6:86206616-86206638 GTAACTGACCATTGAGGAATGGG - Intergenic
1011366938 6:86592961-86592983 GAAACTGTTCATACGGGAAAGGG - Intergenic
1012001750 6:93663078-93663100 GTAACTGTGCATTAGGGAAAGGG + Intergenic
1012205484 6:96455842-96455864 GTAACTGTACACTGAGAAAAGGG + Intergenic
1012225940 6:96703449-96703471 GTAACTGTAAATTGAGGAAAAGG + Intergenic
1012363138 6:98408010-98408032 GTAACTGTGTACTGGGGAAAAGG - Intergenic
1012730280 6:102872934-102872956 GTAACTGTGCACTGAGGAAGGGG + Intergenic
1012820619 6:104081536-104081558 GTAACTGTGCAACGAGGAAAGGG + Intergenic
1014333700 6:120103430-120103452 GTAACCATACACTGGGGAAAGGG + Intergenic
1014534386 6:122598006-122598028 GTAACTGTGCAGTGGGGAAAGGG - Intronic
1014628814 6:123764044-123764066 GTAAGTGTGAAATGAGGAAAAGG + Intergenic
1014631474 6:123795413-123795435 GTAACTGTGCAATGGGGAAAGGG + Intergenic
1014829111 6:126080617-126080639 GTGACTGTGCACTGTGGAAAAGG + Intergenic
1014895512 6:126895175-126895197 GTAACTATGCATTGAGAAAAAGG + Intergenic
1014970080 6:127802831-127802853 GTAACTGTGCATTGTGGAAAGGG + Intronic
1015467114 6:133559613-133559635 GCATCTGTGCACTGGGAAAAGGG - Intergenic
1015926927 6:138320148-138320170 GTACCTGTGCATTAGGAGAAGGG + Intronic
1016147500 6:140694114-140694136 GTAACTGTGCATTGGAGAAAGGG - Intergenic
1016175068 6:141070433-141070455 GTAACTATGCGTTGGGGAAAGGG - Intergenic
1016571295 6:145515919-145515941 GTGACTATGCACTGGGCAAAGGG + Intronic
1016576431 6:145573976-145573998 GTAACTGTGCATTGGGGAAAAGG - Intronic
1017228000 6:152042466-152042488 GTAACTGTGCACTGGGGAAAGGG - Intronic
1017977298 6:159369447-159369469 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1018107512 6:160503185-160503207 GTAACTGTGCACTGGGGACAGGG - Intergenic
1018535193 6:164811857-164811879 GTAACTGTGCGTTGGGGAAAGGG - Intergenic
1018569773 6:165196688-165196710 TTAACCGTGCACTGGGGAAAGGG + Intergenic
1018698868 6:166411804-166411826 GAAACTGTGAATTGGAGAAATGG - Exonic
1018955344 6:168406207-168406229 GTAACTGTGCATTGGTGAAAAGG + Intergenic
1020396532 7:7724202-7724224 TCAACCGTGCATTGGAGAAAGGG - Intronic
1020603214 7:10302832-10302854 GTAACTGTACACTGGGGAAAGGG - Intergenic
1020751451 7:12146634-12146656 CTAACTGTGCACTGGGGGAAAGG - Intergenic
1021788625 7:24177560-24177582 TTTACAGTGCAGTGGGGAAAGGG + Intergenic
1022288238 7:28975782-28975804 GTAACTGTGTACTGAGGAAGGGG + Intergenic
1022393654 7:29965464-29965486 GTCCCTGTGCATTGGGGATGGGG + Intronic
1023303769 7:38801713-38801735 CAACCAGTGCATTGGGGAAAAGG + Intronic
1023970995 7:44990886-44990908 CTACATGTGCACTGGGGAAATGG - Intergenic
1024040065 7:45546084-45546106 GTAACTATACATTGGGGAAAGGG - Intergenic
1024159313 7:46658103-46658125 GTGACTGTGCATTAAGGAAAAGG - Intergenic
1024273640 7:47660205-47660227 GTGACTGGGCAGTGGGGACAAGG + Exonic
1024492030 7:49996491-49996513 GTAACTGTGTCTTGGGGAAAAGG - Intronic
1024641966 7:51336301-51336323 ATAACTATACAATGGGGAAAAGG - Intergenic
1024730921 7:52253003-52253025 GAAACTGAGCAATGGGGATATGG + Intergenic
1024958438 7:54950469-54950491 GTAACTGTGCACTGGGGAAAAGG - Intergenic
1025550431 7:62240198-62240220 GTATTTCTCCATTGGGGAAATGG + Intergenic
1028043682 7:86090078-86090100 GTAGCTGTGCACTGGGGAAAGGG + Intergenic
1028196527 7:87913828-87913850 GTAACTGTGCACTGGGAAAAGGG - Intergenic
1028237645 7:88381466-88381488 GTAACTGTGCATTGGGGAAAGGG + Intergenic
1029816731 7:103104548-103104570 GGAACTGAGCAAGGGGGAAAAGG - Intronic
1029961055 7:104689657-104689679 GTAACTGTGCATTGGGAAAAGGG + Intronic
1030192093 7:106820314-106820336 ATAACTGTGCACTGGGGAAAAGG + Intergenic
1030277275 7:107734712-107734734 GTAACTGTATCTTGGGGAAAGGG + Intergenic
1030312478 7:108082413-108082435 ATAACTGTCTATTGGGGAAGGGG + Intronic
1030368567 7:108672646-108672668 GTAAGTGTGCACTGGGGAAAGGG + Intergenic
1030457640 7:109794423-109794445 GTGACTGTGCAATGGGGAAAGGG - Intergenic
1031199448 7:118661175-118661197 GTAACTGTACACTAGGGAAGTGG + Intergenic
1031474632 7:122206722-122206744 GTAGCTGTGCACTGGGTAAAGGG - Intergenic
1031779304 7:125941624-125941646 GTAACTGTGCACTGGGGAAACGG - Intergenic
1032153291 7:129448326-129448348 GTAACTGTGCACTGGGGAAAGGG - Intronic
1032923603 7:136577182-136577204 GTAACTGTGCACAGGGGAAAGGG - Intergenic
1033076075 7:138251671-138251693 GTAACTGTGCATTGGGGAAAGGG + Intergenic
1033139328 7:138810894-138810916 GTAGCTGTGCACTGGGGAGCAGG + Intronic
1033540156 7:142349179-142349201 GGGTCTGTGCATTGGTGAAAAGG - Intergenic
1033551323 7:142450960-142450982 GTATCTGTGCATTGATGAAAGGG - Intergenic
1033553588 7:142469528-142469550 GTATCTGTGCATTGATGAAAGGG - Intergenic
1034535438 7:151723174-151723196 GCAACTGGGCATTAGGGAAAGGG - Intronic
1034728180 7:153359989-153360011 GACACTGGGCAGTGGGGAAAAGG - Intergenic
1035146120 7:156819635-156819657 ATAACTGTGCTCTGGGGAAAAGG + Intronic
1036142250 8:6219111-6219133 GTAACTGTGCTTTGAGGGAAAGG + Intergenic
1037702114 8:21284691-21284713 GCAACTGTACACTGGAGAAATGG + Intergenic
1038723589 8:30059720-30059742 GTAACTATGCCCTGGGGAAAGGG - Intergenic
1039393452 8:37202066-37202088 GTGACTATGCATTGGGAAAAAGG - Intergenic
1039420494 8:37434135-37434157 GTTACTGTGCACTGGGGGAAAGG - Intergenic
1041463969 8:58140628-58140650 GTAATTGAGCATTGGTGACATGG - Intronic
1041536260 8:58928374-58928396 GCATCTGTCCAGTGGGGAAATGG + Intronic
1041934353 8:63319841-63319863 GTAACTGTGCACTAGAGTAAGGG + Intergenic
1041986001 8:63923099-63923121 GTAACTGTGCACTAGGGAAATGG + Intergenic
1042001242 8:64125368-64125390 GTGACTGTGCATTGAGGAAAAGG - Intergenic
1043232243 8:77817675-77817697 GTAACTGTACATTAAGGAGAAGG + Intergenic
1043260156 8:78185552-78185574 GAAACTGTGCATTGGGGAAAAGG - Intergenic
1043476340 8:80609335-80609357 GTAACTGTGTAAGGAGGAAATGG + Intergenic
1043487432 8:80711807-80711829 GTAAATATGCATGTGGGAAAAGG + Intronic
1044133608 8:88557639-88557661 CTAACTGTACACTGGGGAAAAGG + Intergenic
1044150621 8:88771691-88771713 GTAACTTTGCATTGGGGAAAGGG + Intergenic
1044202214 8:89451098-89451120 GTAAATGTGTATTGGGAAAAGGG + Intergenic
1044286149 8:90413836-90413858 GTAACTGTGCATTGGGGAAAGGG - Intergenic
1044487338 8:92768512-92768534 GTAACCGTGCACTGGGGAAAGGG - Intergenic
1045297145 8:100882047-100882069 GACACTGTGCATGGGGGACATGG - Intergenic
1046064099 8:109176102-109176124 TTAACTGTGCAATGGGGAAAAGG - Intergenic
1046197387 8:110882858-110882880 GTAACTGTGCATTGGAGAAAGGG + Intergenic
1046359629 8:113132769-113132791 GAGACTGTGCATTGGGAATAGGG + Intronic
1046384676 8:113494000-113494022 GTAACTGTGCACTGGAAAAAAGG + Intergenic
1046417832 8:113939198-113939220 GTAACTGTACACTAGGGAAAGGG - Intergenic
1046585959 8:116149022-116149044 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1047047832 8:121074605-121074627 GTAACTCTGCCCTGGGGGAAAGG + Intergenic
1047816830 8:128473820-128473842 GCATCTGTGCAGTGGGGAACGGG - Intergenic
1048084029 8:131158231-131158253 GCAACTGTGCATTAGGAGAAGGG - Intergenic
1048410019 8:134162922-134162944 ATGACTGTGCATTGGGAAAAAGG + Intergenic
1049486791 8:142869272-142869294 GTGACTTTGCACTGGGAAAAAGG - Intronic
1050063730 9:1737347-1737369 GTAATTGTGAACTGGGGAAAGGG - Intergenic
1050355646 9:4780572-4780594 GAATCTGTGCATTTGGGAGAGGG + Intergenic
1050482490 9:6101234-6101256 GTAACTGTGCACTGGGGAAAGGG + Intergenic
1050793412 9:9504445-9504467 GTAAATGTGTGTTGGGGATATGG - Intronic
1051369048 9:16342651-16342673 GTATCTGTGCATAGAGAAAAGGG + Intergenic
1051605838 9:18917134-18917156 GGAAGTGTGCCATGGGGAAATGG - Intergenic
1051722082 9:20047665-20047687 GTAAATGTACATAGAGGAAATGG + Intergenic
1051881961 9:21849270-21849292 GTAACTGTGCACTGGGGAAAGGG + Intronic
1051966269 9:22833205-22833227 GTAACTCTGCATTGGGAAATGGG + Intergenic
1052227422 9:26106984-26107006 GTAACTGTGCATTGTGGAAAGGG + Intronic
1053355889 9:37445217-37445239 GCAACTTTGCATGGGGGAAGAGG + Intronic
1053610682 9:39710109-39710131 GTAACTATGCAACGGGGAAAAGG + Intergenic
1053868717 9:42468131-42468153 GTAACTATGCAACGGGGAAAAGG + Intergenic
1054087572 9:60761049-60761071 GTAACTATGCAACGGGGAAAAGG - Intergenic
1054145658 9:61559273-61559295 GGAACTGGGGATGGGGGAAAGGG + Intergenic
1054242840 9:62632286-62632308 GTAACTATGCAACGGGGAAAAGG - Intergenic
1054465397 9:65490377-65490399 GGAACTGGGGATGGGGGAAAGGG + Intergenic
1054556965 9:66666804-66666826 GTAACTATGCAACGGGGAAAAGG - Intergenic
1054763527 9:69024106-69024128 GGAACTGTGAAATGGTGAAATGG + Intergenic
1055850168 9:80617882-80617904 GTGTGTGTGCATGGGGGAAATGG + Intergenic
1055981444 9:82006540-82006562 GTAAATTTTCATTGGGTAAATGG - Intergenic
1056207233 9:84331932-84331954 ATATCTGTGGAGTGGGGAAAAGG + Intronic
1056314425 9:85374335-85374357 GTAACTGTGCATTAGGGAAAGGG - Intergenic
1057316742 9:93974034-93974056 TTACCATTGCATTGGGGAAAGGG + Intergenic
1057648068 9:96895585-96895607 TTGACTGTGCATTGGGGAAAAGG + Intergenic
1057692806 9:97301317-97301339 GTAACTGTGTATTGAAGAAAAGG - Intergenic
1058019704 9:100074689-100074711 GTAACTGTGCATTGGAGAAAGGG + Intronic
1059707532 9:116838863-116838885 GCAACTGTGAATTGTAGAAAGGG + Intronic
1060321308 9:122564061-122564083 GTAACTGTGCATTGGGAAAAGGG + Intergenic
1060338879 9:122754917-122754939 GTGAATGTGCAATGGAGAAATGG + Intergenic
1060805319 9:126572058-126572080 GTAACTGTGCATTGGAACAAAGG - Intergenic
1185692591 X:2168503-2168525 GTAAATGTGCATACGAGAAATGG + Intergenic
1186029350 X:5350055-5350077 GAAACGGTGCTTTGAGGAAATGG + Intergenic
1186186688 X:7027200-7027222 GTAACTGGGCATAGGGGAGCAGG - Intergenic
1186469956 X:9813467-9813489 GTAACTGTGCATTGGGGAAAGGG - Intronic
1187202084 X:17144780-17144802 GTGACTGTGCATTAGAGGAAGGG + Intronic
1187604704 X:20870680-20870702 GTAACTCTGCATTGGGGAAAGGG + Intergenic
1188414567 X:29916522-29916544 GTAAGTCTGGATTGGGGCAAAGG - Intronic
1188762403 X:34049044-34049066 GTAGTTATACATTGGGGAAAGGG + Intergenic
1189033825 X:37476187-37476209 CTAACTGTGCACTGGGGAAAAGG - Intronic
1190538192 X:51449810-51449832 GTAACTATGCATTGGGGAAAGGG + Intergenic
1190767648 X:53488767-53488789 GTGACTGTACCTTGGGGAAAAGG - Intergenic
1191136633 X:57070828-57070850 GTACCTGTGGATTTGGGAGAAGG - Intergenic
1191226560 X:58050299-58050321 GTAATTGTGCATTGTAGAAAGGG + Intergenic
1191630290 X:63314649-63314671 GTAACTGTGCATTGGGGAAAGGG - Intergenic
1191658994 X:63631368-63631390 GTAACTGTACATTGGGAAAAGGG - Intergenic
1191988361 X:67006019-67006041 GTAACTGTGCATTGGAAAAAGGG - Intergenic
1192297888 X:69869389-69869411 GTAACTGTGCACTGGGGAAAGGG - Intronic
1192346639 X:70314343-70314365 ATTACTGTGGATTGGGGGAAAGG + Intronic
1192658058 X:73013127-73013149 GTAAATATACATTGGGGAAAGGG - Intergenic
1192661741 X:73049143-73049165 GTAACTCTGCACTGGGGAAAGGG - Intergenic
1192793300 X:74405716-74405738 GAATCTGTGCACTTGGGAAAGGG + Intergenic
1193053240 X:77123796-77123818 ATAACTGTGCACTGGGGAAAGGG + Intergenic
1193187236 X:78527850-78527872 GTGATTGTGCATGGAGGAAAAGG + Intergenic
1193446986 X:81617396-81617418 GTAACTGTGCACTGGGGAAAGGG + Intergenic
1193531502 X:82659951-82659973 GTAACTGTACATTGGGAAAAAGG - Intergenic
1193543268 X:82796720-82796742 GTAAATGTGCTTTGGCAAAAAGG + Intergenic
1193832768 X:86308724-86308746 GTAACTGTGCACTGGGGAAAGGG + Intronic
1193841583 X:86413984-86414006 ATAACTGTGCATTGGGAAAAGGG - Intronic
1193877108 X:86873926-86873948 GTAACTGTGCATTGGGGAAATGG + Intergenic
1193914992 X:87353319-87353341 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1194032177 X:88831243-88831265 GTAACTGTGCACTGAGGAAAGGG - Intergenic
1194210100 X:91060979-91061001 GTAACTGTGCATTGAGGAAAGGG + Intergenic
1194343140 X:92729714-92729736 GTAACTATGCATTGGGGAAAGGG + Intergenic
1194385827 X:93254287-93254309 ATAACTGTGCATTGAGGAAAAGG - Intergenic
1194513597 X:94823632-94823654 GTAACTGTGCATTGCAGAAAGGG - Intergenic
1194604574 X:95963367-95963389 GTAACTGTGCGTTGGAGAAAGGG - Intergenic
1194671898 X:96743687-96743709 GTAATTGGGCAGTGGGGAGAGGG + Intronic
1194788602 X:98118196-98118218 GAATCTGTGCACTTGGGAAAAGG + Intergenic
1194833768 X:98657409-98657431 GTAACTGTGAATTGGGGAAAGGG + Intergenic
1194894241 X:99419638-99419660 CTAACTGTGCATTGGAGAAGAGG - Intergenic
1195749026 X:108146033-108146055 GTAACTGTGCATTGGGGGAAGGG - Intronic
1195782547 X:108481256-108481278 GTAACTATGCATTGGGGAGAGGG - Intronic
1195809842 X:108817208-108817230 GTAATTGTGCACTGGGGAAAGGG - Intergenic
1196153112 X:112396255-112396277 GAATCTGTGCATTTGGGAGAGGG - Intergenic
1196275641 X:113762724-113762746 GTAACTGTGCATTGGGGAAAAGG + Intergenic
1196485140 X:116197609-116197631 GTAACTGTGTATTGGGGAAAAGG + Intergenic
1197002106 X:121451567-121451589 GTAACTGTGCATTAGGAAAAGGG + Intergenic
1197044275 X:121977060-121977082 GTAACTATACATTGAGGAATGGG + Intergenic
1197084377 X:122454889-122454911 GTAACTGTGCACTGGGGAAAGGG - Intergenic
1197097286 X:122611452-122611474 ATAAGTGTGCATTGAGGAAAGGG + Intergenic
1197380178 X:125729321-125729343 GTAACTGTGCGTTAGGAAAAGGG - Intergenic
1197380526 X:125732652-125732674 GTAACTGTGCATTGGGAAAAGGG - Intergenic
1197386987 X:125814057-125814079 GTAACTGTGCATTGGGGAAGGGG - Intergenic
1197425928 X:126297006-126297028 GTAACTGTGCATTGGGGAAAGGG - Intergenic
1197554440 X:127936936-127936958 ATAACTGTGCATTGGGGAAAGGG - Intergenic
1197591686 X:128417957-128417979 GTAACTGTGCATTGGGGGAAGGG + Intergenic
1198169844 X:134094876-134094898 GTAACTGTACACTGGGGAAAAGG + Intergenic
1198186516 X:134258735-134258757 GTAACTGTGCACTAGAGAAAGGG - Intergenic
1198701109 X:139398904-139398926 GTAACTGTGCATTGGGGAAAGGG + Intergenic
1198783221 X:140259187-140259209 GTAACTGTGCATTTTGAGAAAGG - Intergenic
1198933834 X:141886463-141886485 GTAACTGTGCACTGGGGAAAGGG + Intronic
1199144625 X:144350352-144350374 GCAACTGTGCATTGGAGAAAGGG - Intergenic
1199303836 X:146244380-146244402 GAATCTGTGCATTTGGGAGATGG + Intergenic
1200651498 Y:5846380-5846402 GTAACTATGCATTGGGGAAAGGG + Intergenic
1201304825 Y:12541556-12541578 GTCACTGTGCAGAGGGGAAGCGG - Intergenic
1201529807 Y:14979332-14979354 GTAACCATCCATTGGGGAAAAGG - Intergenic
1201796798 Y:17904944-17904966 GTAATTGTGTACTAGGGAAAGGG - Intergenic
1201798278 Y:17925315-17925337 GTAACTGTGCATGGAAGAAAGGG + Intergenic
1201803275 Y:17980642-17980664 GTAACTGTGCATGGAAGAAAGGG - Intergenic
1201804755 Y:18001041-18001063 GTAATTGTGTACTAGGGAAAGGG + Intergenic
1202341254 Y:23871280-23871302 GTGACTGTGCATTAGGGAAAGGG - Intergenic
1202358177 Y:24074006-24074028 GTAATTGTGTACTAGGGAAAGGG - Intergenic
1202512601 Y:25596107-25596129 GTAATTGTGTACTAGGGAAAGGG + Intergenic
1202529512 Y:25798806-25798828 GTGACTGTGCATTAGGGAAAGGG + Intergenic