ID: 1067333138

View in Genome Browser
Species Human (GRCh38)
Location 10:45340215-45340237
Sequence AGTTATATGCAGAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067333138_1067333141 22 Left 1067333138 10:45340215-45340237 CCTGCCATTTTCTGCATATAACT No data
Right 1067333141 10:45340260-45340282 CTTGGCCTGTTACTGAGCTTTGG No data
1067333138_1067333140 4 Left 1067333138 10:45340215-45340237 CCTGCCATTTTCTGCATATAACT No data
Right 1067333140 10:45340242-45340264 TGCTTTTGAAAGACAGCTCTTGG No data
1067333138_1067333142 25 Left 1067333138 10:45340215-45340237 CCTGCCATTTTCTGCATATAACT No data
Right 1067333142 10:45340263-45340285 GGCCTGTTACTGAGCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067333138 Original CRISPR AGTTATATGCAGAAAATGGC AGG (reversed) Intergenic
No off target data available for this crispr