ID: 1067338410

View in Genome Browser
Species Human (GRCh38)
Location 10:45382077-45382099
Sequence ATTCAATGCAGTATCTAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 115}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067338410_1067338423 25 Left 1067338410 10:45382077-45382099 CCCCCTTAGATACTGCATTGAAT 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1067338423 10:45382125-45382147 CAAGGGGCTTGGGCTAGGGCAGG No data
1067338410_1067338416 8 Left 1067338410 10:45382077-45382099 CCCCCTTAGATACTGCATTGAAT 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1067338416 10:45382108-45382130 GTGAGATGTGATAAGGCCAAGGG No data
1067338410_1067338420 20 Left 1067338410 10:45382077-45382099 CCCCCTTAGATACTGCATTGAAT 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1067338420 10:45382120-45382142 AAGGCCAAGGGGCTTGGGCTAGG No data
1067338410_1067338421 21 Left 1067338410 10:45382077-45382099 CCCCCTTAGATACTGCATTGAAT 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1067338421 10:45382121-45382143 AGGCCAAGGGGCTTGGGCTAGGG No data
1067338410_1067338418 14 Left 1067338410 10:45382077-45382099 CCCCCTTAGATACTGCATTGAAT 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1067338418 10:45382114-45382136 TGTGATAAGGCCAAGGGGCTTGG No data
1067338410_1067338417 9 Left 1067338410 10:45382077-45382099 CCCCCTTAGATACTGCATTGAAT 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1067338417 10:45382109-45382131 TGAGATGTGATAAGGCCAAGGGG No data
1067338410_1067338415 7 Left 1067338410 10:45382077-45382099 CCCCCTTAGATACTGCATTGAAT 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1067338415 10:45382107-45382129 CGTGAGATGTGATAAGGCCAAGG No data
1067338410_1067338414 1 Left 1067338410 10:45382077-45382099 CCCCCTTAGATACTGCATTGAAT 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1067338414 10:45382101-45382123 AATCATCGTGAGATGTGATAAGG No data
1067338410_1067338419 15 Left 1067338410 10:45382077-45382099 CCCCCTTAGATACTGCATTGAAT 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1067338419 10:45382115-45382137 GTGATAAGGCCAAGGGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067338410 Original CRISPR ATTCAATGCAGTATCTAAGG GGG (reversed) Intronic
902463181 1:16595214-16595236 TTTCAATGCGGTCTCTAAAGCGG - Intronic
904869604 1:33608205-33608227 AGTCAATGGAGAATCTGAGGCGG + Intronic
907427577 1:54390572-54390594 ATTCACTGCGGTATTTAAAGTGG + Intronic
908798045 1:67851037-67851059 ATTCATTGCAGTGTATTAGGAGG - Intergenic
912275023 1:108247229-108247251 ATTCAATGCATTCTCTAAAGTGG - Intergenic
912293199 1:108447122-108447144 ATTCAATGCATTCTCTAAAGTGG + Intronic
913127179 1:115803349-115803371 ATTCAATTCAGTATTTTGGGGGG - Intergenic
913277176 1:117149681-117149703 ATTCATTTCAGTATCTCAGGGGG + Intronic
914343398 1:146778490-146778512 TTTCAAAGCAGTTTCTATGGTGG - Intergenic
914945042 1:152057585-152057607 ATTTAATGCATTATCTCAGTAGG + Intergenic
918110263 1:181449574-181449596 TCTCAATGCAGAAGCTAAGGGGG - Intronic
918162874 1:181917684-181917706 ATTCAATGTAGGAAGTAAGGAGG + Intergenic
918732402 1:188014252-188014274 ATGCAATGCAGTATCAGAGATGG - Intergenic
920576034 1:207061372-207061394 CTTCACTGCAGTACCCAAGGTGG - Intronic
923557868 1:235015246-235015268 ATTCAATACATTATCTAGAGTGG - Intergenic
1063928364 10:11003391-11003413 TTTCCATGCAGTTTCTAATGGGG - Intergenic
1063972035 10:11387983-11388005 ATTCAATTCTGTATCTAATGTGG + Intergenic
1064131001 10:12709426-12709448 TTGCAATGCAGAGTCTAAGGAGG + Intronic
1064399921 10:15012776-15012798 ATTCAGTGCAGTATTTCAGGTGG - Intergenic
1067338410 10:45382077-45382099 ATTCAATGCAGTATCTAAGGGGG - Intronic
1070004391 10:72409110-72409132 AATAAATGCAGTTTCTAAGAAGG + Intronic
1070461495 10:76674954-76674976 CTTCTTTGCAGAATCTAAGGTGG + Intergenic
1080483181 11:32674307-32674329 ATTCAAAGCAGTATCGAGAGAGG + Intronic
1085024044 11:73226303-73226325 AGTCAAGGCATTTTCTAAGGAGG + Intronic
1087484757 11:98747497-98747519 ATTCAATGCAGTACCTGGTGAGG - Intergenic
1087560244 11:99781362-99781384 ACTCAATGCATTATTTAAGGTGG + Intronic
1090592364 11:128286049-128286071 ATTAAATACAGTAACTATGGAGG - Intergenic
1091242374 11:134062491-134062513 ATTCAAGGCAGTAGATGAGGGGG + Intergenic
1092502156 12:9059063-9059085 ATTCAATCTTGTATCTAATGTGG - Intergenic
1094299999 12:28953452-28953474 ATTCCATTCAGTATTTAAGAAGG - Intergenic
1096506711 12:52098343-52098365 ATTCAGTGCACTATTTCAGGTGG + Intergenic
1099057278 12:77859287-77859309 TTACAATATAGTATCTAAGGTGG - Intronic
1099092424 12:78330052-78330074 ATTCAATGCAGAAAATAAAGAGG - Intergenic
1100253407 12:92856385-92856407 AATCACTGCAGTATCAAAAGTGG - Intronic
1106658931 13:31778092-31778114 ATTTAATGCAGTTTCCAATGTGG + Intronic
1106757952 13:32840952-32840974 CTTCAAGGCAGTATCCAAGGGGG + Intergenic
1110439267 13:75508656-75508678 ATACACTGCAGTATTTAAGGGGG + Intergenic
1111245031 13:85526270-85526292 AATCTATGCAGTAGATAAGGTGG - Intergenic
1113405375 13:110033978-110034000 ATGCAATCCAGCATCTAAGTAGG + Intergenic
1116339778 14:43707004-43707026 ATTCAATGAAGTAACAAAAGGGG + Intergenic
1117122968 14:52588495-52588517 CTTCAATGCATTATATCAGGAGG - Intronic
1119077198 14:71653224-71653246 ATTCAATGAAGTGTCTACTGTGG + Intronic
1120045702 14:79803171-79803193 AATCAATGAATTATCTAATGTGG + Intronic
1120339012 14:83194884-83194906 ATTCTCTGCAGTAGTTAAGGAGG + Intergenic
1131561145 15:93441097-93441119 ATTCAGTTCAGGATCTCAGGTGG - Intergenic
1131635949 15:94233062-94233084 ATTCCATGCTGTCTCTAAGATGG + Intronic
1139211164 16:65078509-65078531 ATTCAATGATGTATTTAATGGGG - Intronic
1139990591 16:70936843-70936865 TTTCAAAGCAGTTTCTATGGTGG + Intronic
1140801402 16:78491640-78491662 TTTCAATGCAGTATATAAGAGGG + Intronic
1144237329 17:13274300-13274322 ATTCAATGAAGTATTCAAGATGG - Intergenic
1146245037 17:31273051-31273073 ATTCAATGCAATAAATATGGGGG + Intronic
1202678842 1_KI270711v1_random:32647-32669 TTTCAATGCGGTCTCTAAAGCGG - Intergenic
925799276 2:7581640-7581662 TTTCAATTCAGTATGTCAGGAGG - Intergenic
926320367 2:11745082-11745104 ATTCGATGCTGTTTCTAAGCTGG + Intronic
926342171 2:11912601-11912623 ATTTAATGCTGTACCTCAGGGGG - Intergenic
926368610 2:12157234-12157256 ATTCAGTGAGGTATTTAAGGGGG + Intergenic
926796107 2:16620401-16620423 ATTCACTGCAGCATCAATGGTGG + Intronic
926849965 2:17185733-17185755 ATTCAATGCTGAATATCAGGCGG - Intergenic
930541475 2:52712368-52712390 GATCAATGCAGTCTCCAAGGTGG + Intergenic
931404164 2:61960428-61960450 ACTTAATACAGTAGCTAAGGAGG + Intronic
932175980 2:69602700-69602722 TGTCACTGCAGTATCAAAGGAGG - Intronic
932311182 2:70743071-70743093 ATTTAATGAATTAGCTAAGGAGG + Intronic
932947230 2:76249523-76249545 ATTAATTGCAGAATCTAGGGTGG + Intergenic
933401816 2:81808239-81808261 ATTCTATGTAGAATGTAAGGAGG + Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
937499625 2:122463678-122463700 ATTCAGTGCAGCATATGAGGGGG - Intergenic
938266318 2:129930751-129930773 AAACAATGCAGCATCCAAGGAGG - Intergenic
939238202 2:139524625-139524647 ACTCACTGCAGTATCTGAGTAGG + Intergenic
939957268 2:148537651-148537673 CTTCAAAACAGTATCTCAGGAGG - Intergenic
942500658 2:176587210-176587232 ATTCAAGGCAGTGTGTAGGGTGG + Intergenic
943536221 2:189153924-189153946 AGGCAATGCAGAATCTTAGGGGG - Intronic
945595157 2:211781913-211781935 ATGCACTGCAGTCTCTAAGGGGG + Intronic
945609429 2:211980661-211980683 ATACAATACTGAATCTAAGGAGG - Intronic
1170369639 20:15635122-15635144 ATTGAATGCAGTAGCTTAGCTGG - Intronic
1171509390 20:25668806-25668828 ATTCAAAAGAGTATCTGAGGTGG + Intergenic
1177356221 21:20011733-20011755 ACTCAAGGGAGTATTTAAGGAGG - Intergenic
1177525999 21:22290634-22290656 ATTCAATGCTGAATACAAGGGGG - Intergenic
1184781025 22:46649554-46649576 CACCAATGCAGGATCTAAGGTGG - Intronic
1184829616 22:46976055-46976077 ATTCAATCCTTTTTCTAAGGGGG - Intronic
958440734 3:94153363-94153385 ATACAATGCAGTATGTTAGAAGG + Intergenic
962069146 3:132014675-132014697 ATTCCATGGTGTATATAAGGAGG + Intronic
964609456 3:158595697-158595719 ATTAAGTGCAGGTTCTAAGGAGG + Intronic
965580374 3:170261270-170261292 ATTAAATGCAGTATATTAAGAGG - Intronic
966007512 3:175034165-175034187 ATTAAATGGAGTGTCAAAGGTGG - Intronic
966750489 3:183317027-183317049 ATTAAATTCAGTCTTTAAGGAGG - Intronic
974590106 4:63937258-63937280 ATTCAATTCAGAATCTCATGTGG + Intergenic
975763589 4:77642332-77642354 GTTCAATGCAGTCTCTGAGAGGG - Intergenic
978169548 4:105652704-105652726 TTTAAATGCAGTTTCCAAGGAGG - Intronic
978865307 4:113501016-113501038 ATTTAATGAAGAAGCTAAGGGGG + Intronic
979084329 4:116387950-116387972 ATTCATTTCAGTATTTAAAGAGG - Intergenic
980076199 4:128295813-128295835 ATCCAATGCAGTCTCTCAGGTGG + Intergenic
981557490 4:146010716-146010738 ATTCAGTAGGGTATCTAAGGAGG - Intergenic
981857740 4:149314314-149314336 ATTCAAGGCACTATATAAGTAGG + Intergenic
982409656 4:155060075-155060097 AATGAATGCTGTATCTAAGCAGG - Intergenic
983672251 4:170251674-170251696 ATTCCATGCAGTCTCCAAAGGGG + Intergenic
984807207 4:183762784-183762806 ATTCAATGCATTAGCTCAAGTGG - Intergenic
990155001 5:52866748-52866770 ATTAAACTCAGTATCTAAAGTGG - Intronic
991067519 5:62440122-62440144 ACTCAATGTAGTATAGAAGGTGG + Intronic
992930109 5:81634601-81634623 ATACAATGCAGTTTTTAAGCAGG - Intronic
995591918 5:113708316-113708338 AATGAATGGAGTAACTAAGGTGG + Intergenic
995998240 5:118326323-118326345 ATCCAATACATTATTTAAGGAGG + Intergenic
999357747 5:150953170-150953192 ATTCATTGCAGTGTGTAGGGTGG + Intergenic
999411287 5:151352059-151352081 AGCAAATGCAGTATCCAAGGAGG - Intergenic
1003892000 6:10571907-10571929 ATTCAAATCATTATCTCAGGGGG - Intronic
1004030117 6:11860032-11860054 TTTCTATTCAGTTTCTAAGGGGG - Intergenic
1006046234 6:31301111-31301133 CTTGAAAGCAGTATCTATGGTGG + Intronic
1011116915 6:83904189-83904211 AGCAAAAGCAGTATCTAAGGGGG - Intronic
1019097612 6:169597705-169597727 ATTCAATTCTGGAGCTAAGGAGG - Intronic
1020306810 7:6841851-6841873 ATTTAATGCAATATTTCAGGTGG - Intergenic
1023388472 7:39684352-39684374 ATTGAAAGCAGTCTCCAAGGAGG + Intronic
1030793068 7:113753326-113753348 ATATAATACAGCATCTAAGGTGG - Intergenic
1030964114 7:115968117-115968139 TTTAAATTCAGTATTTAAGGTGG + Intronic
1032156030 7:129469022-129469044 AGTCAATTCAGTCTCTGAGGTGG - Intronic
1036771874 8:11584402-11584424 AGACAATGCAGTATCAATGGAGG + Intergenic
1038390558 8:27195862-27195884 ATTCAATGAAGTATATAAAATGG - Intergenic
1049511923 8:143031834-143031856 ATACAATGGAGTCTCTAAGATGG - Intergenic
1052371840 9:27674351-27674373 TTTCTAAGTAGTATCTAAGGGGG + Intergenic
1052697515 9:31897224-31897246 AATCAATGAAGTATTTAATGGGG + Intergenic
1053859397 9:42371578-42371600 ATCAAGTGCAGTATCTATGGAGG + Intergenic
1062296417 9:135830600-135830622 ATTCTATCCAGTATTTAAAGTGG - Intronic
1186124061 X:6393594-6393616 ATTTAATGGAGTCTCTAAAGTGG + Intergenic
1186978812 X:14937052-14937074 GTTAAATGCAGTATCTCAGCTGG + Intergenic
1189112023 X:38301472-38301494 ATTCAAGGCAGAATTTGAGGGGG - Intronic
1190918515 X:54827553-54827575 CTTCAAGGCAGCAGCTAAGGTGG + Intergenic
1193650410 X:84123914-84123936 ATTCAATGCAGTCTGTGTGGTGG + Intronic
1195763854 X:108275712-108275734 ATGCAATGTATAATCTAAGGGGG + Intronic
1195989122 X:110665382-110665404 ATGCAATGCAGTGGGTAAGGAGG - Intergenic
1201984353 Y:19948437-19948459 ATACAATGGATTATCTAAGAAGG - Intergenic