ID: 1067339142

View in Genome Browser
Species Human (GRCh38)
Location 10:45387053-45387075
Sequence GCGTGCCAGGCGCCGTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067339138_1067339142 -4 Left 1067339138 10:45387034-45387056 CCATCCATTGGCATTTACTGCGT 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1067339142 10:45387053-45387075 GCGTGCCAGGCGCCGTGTGGAGG No data
1067339137_1067339142 -3 Left 1067339137 10:45387033-45387055 CCCATCCATTGGCATTTACTGCG 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1067339142 10:45387053-45387075 GCGTGCCAGGCGCCGTGTGGAGG No data
1067339139_1067339142 -8 Left 1067339139 10:45387038-45387060 CCATTGGCATTTACTGCGTGCCA No data
Right 1067339142 10:45387053-45387075 GCGTGCCAGGCGCCGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067339142 Original CRISPR GCGTGCCAGGCGCCGTGTGG AGG Intronic
No off target data available for this crispr