ID: 1067343528

View in Genome Browser
Species Human (GRCh38)
Location 10:45422277-45422299
Sequence CAGAATGAGAGGATGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067343528_1067343534 -10 Left 1067343528 10:45422277-45422299 CCAGCCTCCATCCTCTCATTCTG No data
Right 1067343534 10:45422290-45422312 TCTCATTCTGCTGGATCAGGAGG No data
1067343528_1067343535 -4 Left 1067343528 10:45422277-45422299 CCAGCCTCCATCCTCTCATTCTG No data
Right 1067343535 10:45422296-45422318 TCTGCTGGATCAGGAGGATGTGG No data
1067343528_1067343536 -3 Left 1067343528 10:45422277-45422299 CCAGCCTCCATCCTCTCATTCTG No data
Right 1067343536 10:45422297-45422319 CTGCTGGATCAGGAGGATGTGGG No data
1067343528_1067343537 -2 Left 1067343528 10:45422277-45422299 CCAGCCTCCATCCTCTCATTCTG No data
Right 1067343537 10:45422298-45422320 TGCTGGATCAGGAGGATGTGGGG No data
1067343528_1067343538 1 Left 1067343528 10:45422277-45422299 CCAGCCTCCATCCTCTCATTCTG No data
Right 1067343538 10:45422301-45422323 TGGATCAGGAGGATGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067343528 Original CRISPR CAGAATGAGAGGATGGAGGC TGG (reversed) Intronic
No off target data available for this crispr