ID: 1067343986

View in Genome Browser
Species Human (GRCh38)
Location 10:45424995-45425017
Sequence TTTGGCTACCAGTTCCTGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067343981_1067343986 20 Left 1067343981 10:45424952-45424974 CCTGGTAGAGCGGGTCATGAATC 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1067343986 10:45424995-45425017 TTTGGCTACCAGTTCCTGAATGG 0: 1
1: 0
2: 1
3: 24
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067343986 Original CRISPR TTTGGCTACCAGTTCCTGAA TGG Exonic
900627458 1:3615492-3615514 TTTGGCTATGATTTCCTGAAAGG - Intergenic
903687490 1:25142570-25142592 CTTCGCTTCCTGTTCCTGAAAGG + Intergenic
905382236 1:37571071-37571093 TTTGGCTTTCAGTTTCTGAAGGG + Intronic
907567405 1:55448712-55448734 TTTAGCCACCAAATCCTGAAAGG + Intergenic
911812374 1:102299210-102299232 TTTGGTTGCCTGTTCCTGTAGGG - Intergenic
912707730 1:111927388-111927410 TTTGGAGACCCCTTCCTGAATGG + Intronic
915065975 1:153224394-153224416 TTTGTCAGCCAGTCCCTGAAGGG + Intergenic
919453462 1:197798167-197798189 TTTGTCTATCAGCTCCTGTATGG + Intergenic
921164497 1:212496766-212496788 TTTGGCTACCAGATCGGGTAAGG - Intergenic
921445691 1:215244458-215244480 TTTGGCTACCACGTCTTGGAGGG - Intergenic
923148823 1:231216415-231216437 TTGGGCTGCCAGTTTCAGAAAGG - Exonic
1064704733 10:18059958-18059980 TTTGGATACAAGCTGCTGAAAGG - Intergenic
1067343986 10:45424995-45425017 TTTGGCTACCAGTTCCTGAATGG + Exonic
1067579816 10:47436211-47436233 TTTAGCTAGCAGTTTCTCAATGG + Intergenic
1070503674 10:77094603-77094625 TTTGGCTTAGAGTTCCTGACCGG - Intronic
1072699541 10:97630536-97630558 TTTGGCAAGCATTTGCTGAAGGG - Intronic
1080633765 11:34105619-34105641 GCTGTCTACCAGTTCCTGAGAGG + Exonic
1084973647 11:72784753-72784775 TCTGGGTCCCAGTTCCAGAATGG + Intronic
1087478003 11:98662012-98662034 TTTTGCTACTAGTTCCTTGAAGG - Intergenic
1094301947 12:28974319-28974341 TTTGGATACCATTGACTGAAAGG - Intergenic
1094459709 12:30682159-30682181 TTTGGTTACCATATCCTGAATGG + Intronic
1102150291 12:110684993-110685015 TTTGCCTACCACACCCTGAAGGG - Intronic
1102923632 12:116810753-116810775 TTTGGCTCCCTGCTCCTGAGGGG + Intronic
1105227905 13:18454098-18454120 TTTGTCTAACACATCCTGAATGG - Intergenic
1106674541 13:31944543-31944565 TTTGGAGACCTGTTGCTGAAAGG + Intergenic
1109852560 13:68086377-68086399 TTTGGTTACAAGTTCCTTATTGG + Intergenic
1110031657 13:70622651-70622673 TTTGGTTATAATTTCCTGAAAGG + Intergenic
1111251563 13:85608372-85608394 TCTGGCTACCTCTTACTGAATGG - Intergenic
1114654370 14:24307371-24307393 TTTGGCTAGCAGCTCCTGGCGGG + Exonic
1115848317 14:37562901-37562923 TTTGGCTTCCTGTTCCTTCATGG - Intergenic
1118125860 14:62903166-62903188 TTTGGCAAACATTTGCTGAAGGG - Intronic
1118865882 14:69703255-69703277 TTTGGTTAACAGTTCCTCCAAGG + Intronic
1119021646 14:71121362-71121384 TTTGCCTACCATCTCCTGATTGG + Intergenic
1121251804 14:92505299-92505321 TCTGGATTCCAGTTTCTGAAGGG + Intergenic
1123222733 14:106872183-106872205 CTTTCCTACGAGTTCCTGAATGG - Intergenic
1124617696 15:31254382-31254404 TCTGGAGACCAGGTCCTGAAAGG + Intergenic
1125600346 15:40912236-40912258 TCTGGCTCCCAGCTCCTGATGGG + Intergenic
1126199242 15:45967037-45967059 TTTGGTTTGCAGCTCCTGAAAGG - Intergenic
1126498846 15:49322487-49322509 GTTGGCTGCAAGTTACTGAAAGG + Intronic
1127544124 15:59974294-59974316 TTTGGGTACCACTTCATGGAAGG - Intergenic
1129147770 15:73664471-73664493 TTTAGCTAACAGTTTCTGATTGG - Intergenic
1129781207 15:78272626-78272648 TTTGGCCACCGGTTACAGAAGGG + Intronic
1132230475 15:100180056-100180078 TTTGGCTGCCTGTTCCTGTGGGG + Intronic
1134778231 16:16871556-16871578 TTTGGCTGTCAGTTTCTGAAAGG + Intergenic
1137465251 16:48702556-48702578 TCTGGCTAGAACTTCCTGAAAGG + Intergenic
1143125341 17:4638320-4638342 TTTGGGTACCAGTTTCTTAATGG - Exonic
1143403163 17:6658789-6658811 TTTGGGTACCAGTTTCTTAATGG + Intergenic
1143432196 17:6895378-6895400 TTTGGGTACCAGTTTCTCAATGG + Intronic
1143444487 17:6999341-6999363 TTCAGCTACCAGTTCCTCAATGG + Exonic
1143457068 17:7075208-7075230 CCTGGCTTCCAGTTCCTGAGAGG + Exonic
1143615073 17:8044864-8044886 TTCGCCTCCCAGTTCCTGAATGG + Exonic
1143620925 17:8079884-8079906 TTTGGGTACCAGTACCTCAACGG - Exonic
1143626208 17:8111474-8111496 TTTGGGTACCAGTACCTGAATGG - Exonic
1147988213 17:44318533-44318555 CTGGGCCACCAGTTCCTGAGGGG - Exonic
1154525474 18:15285369-15285391 TTTGTCTAACACATCCTGAATGG + Intergenic
1156316623 18:35974676-35974698 TTTGCCTATCTGTTGCTGAAAGG + Intronic
1160050273 18:75426941-75426963 ATTGGCTACTGGTTCATGAATGG + Intronic
1160923503 19:1531815-1531837 TTTGGCTACCAGCTCTTGGACGG + Exonic
1163859050 19:19731218-19731240 TTTGGGTACCCTATCCTGAAAGG - Intronic
1164786923 19:30940512-30940534 TTTAGCTTGCACTTCCTGAAGGG + Intergenic
1165018604 19:32903774-32903796 TTTGGCTATTATTTCTTGAACGG - Intronic
1167772802 19:51531375-51531397 TATGGCTACTGGTTCCTGGAAGG - Exonic
926111986 2:10189383-10189405 TTTGGCTGCCAGTTTCTAAATGG - Intronic
928632963 2:33213052-33213074 TCTGGCAACCAGGTCCTGTAAGG - Intronic
929584859 2:43107181-43107203 GTTGGTTTCCAGTTCCTGGACGG - Intergenic
930351237 2:50257583-50257605 TCTGTCTACCAGTATCTGAAAGG + Intronic
931692047 2:64842271-64842293 TGTGGCCTCCAGTTCCTGAGAGG + Intergenic
938932641 2:136100259-136100281 ATTGGCTACAATTTCCTAAATGG - Intergenic
941273457 2:163460006-163460028 CTTGGCTTCCAGTTCCAGCATGG - Intergenic
942936602 2:181564214-181564236 TGTGCCTCCCAGTTCCTAAAAGG + Intronic
943165754 2:184323577-184323599 TTTGACTATCAAATCCTGAATGG + Intergenic
946471984 2:219969079-219969101 TTTTCCTATGAGTTCCTGAAGGG + Intergenic
949035222 2:241813090-241813112 CTGGGCCACCGGTTCCTGAAAGG - Intronic
1169550811 20:6699338-6699360 TTTGCCAGCCAGTTTCTGAAGGG - Intergenic
1170540363 20:17381511-17381533 TTTGGCTTGCAGTACCTCAATGG - Intronic
1171297374 20:24030128-24030150 TTTGACAACCAGTTTCTCAAGGG - Intergenic
1171869968 20:30516871-30516893 TCTGGATAACACTTCCTGAATGG + Intergenic
1174986735 20:55462611-55462633 GTTGGGGACCAGTGCCTGAAGGG + Intergenic
1178739611 21:35186066-35186088 TGTGGCTACCAGCACCAGAATGG + Intronic
1179105375 21:38395824-38395846 TCTGGCTACCCTTTCCTGGAGGG + Intronic
1179677960 21:42997609-42997631 TTGGACTACAAGTTCCTTAAGGG - Intronic
1180518996 22:16176791-16176813 TTTGTCTAACACATCCTGAATGG - Intergenic
1182957931 22:34444817-34444839 TTTGGGTAACAGTTCATCAAAGG - Intergenic
1183371982 22:37437982-37438004 TTGTGCTACCACTTCCTGACTGG + Intergenic
1184028632 22:41877502-41877524 CTTGGCTACCAGGTCCCAAAGGG + Intronic
1184483797 22:44764268-44764290 ATTTGCTACCAGTCCCTGCAGGG - Intronic
1184789640 22:46691951-46691973 TTTGGGTACCACTTCCTGCGGGG - Intronic
953915436 3:46917205-46917227 ATTAGCTTCCACTTCCTGAAGGG - Intergenic
954258149 3:49420363-49420385 TTTGGCTTCCAGGTCCAGGAGGG + Intronic
956309025 3:67858739-67858761 TTTGGGTACCAGTTTGTGCAAGG + Intergenic
958581566 3:96032262-96032284 TTAGACTACAAGTTTCTGAAGGG + Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
961316863 3:126043425-126043447 TTTGGCTTCAAGTTCCTGTCTGG - Intronic
962725351 3:138220506-138220528 TTTCCCTACAAGTTTCTGAATGG - Intronic
963600159 3:147371815-147371837 TTTGGCTACCACTTCCAGGAAGG + Intergenic
963980281 3:151529202-151529224 TTTATCTACAAGTCCCTGAATGG - Intergenic
968759749 4:2436698-2436720 TCTGGGGACCAGTTCCTGAGTGG + Intronic
976879290 4:89899224-89899246 TTTGGCCAGGAGTTCCTGCAAGG - Intronic
977509070 4:97938505-97938527 TCTGGCTAAGAGTTCCTGCAGGG - Intronic
981366821 4:143913470-143913492 TTAAGCTGTCAGTTCCTGAAGGG - Intergenic
981376618 4:144023707-144023729 TTAAGCTGTCAGTTCCTGAAGGG - Intergenic
981387122 4:144145052-144145074 TTAAGCTGTCAGTTCCTGAAGGG - Intergenic
981467588 4:145092019-145092041 GATGGCTTCCAGCTCCTGAAAGG - Intronic
982381488 4:154753877-154753899 TGTGGGTTCCAGTTCCTGCAGGG + Intergenic
984642135 4:182178344-182178366 TTTTACAACCAGTTCCTGAGAGG + Intronic
986186364 5:5444898-5444920 AATTCCTACCAGTTCCTGAAAGG - Intronic
986342256 5:6800800-6800822 CTAGGCTAAAAGTTCCTGAAAGG - Intergenic
986381362 5:7189667-7189689 TTCGGCAACCATTTACTGAAAGG - Intergenic
987240755 5:15996165-15996187 TTTAGGTACCAGTCCCTAAATGG + Intergenic
987759346 5:22140016-22140038 TTTGGCAACACGTTTCTGAAAGG - Intronic
990530821 5:56671746-56671768 TTTGGTCACCAGTTTCTCAATGG + Intergenic
991894064 5:71373445-71373467 TTTGGCAACACGTTTCTGAAAGG - Intergenic
993111762 5:83665389-83665411 TTTGGCTCAGAGTTACTGAAGGG - Intronic
995854509 5:116577338-116577360 TTTGGCTTTCTTTTCCTGAAGGG - Intergenic
999037476 5:148368742-148368764 TCTGGATACTAGTTCCTTAATGG + Intergenic
999702326 5:154239363-154239385 TGTGCCAGCCAGTTCCTGAAAGG - Intronic
1000365038 5:160482683-160482705 TATGGCTATCAGTTGATGAATGG - Intergenic
1001687502 5:173605184-173605206 TGTGTCTAACAGCTCCTGAAGGG - Intergenic
1003567419 6:7232211-7232233 TCTGGCTACCACCTCCGGAAGGG - Intronic
1008242920 6:49134268-49134290 ATTTGCTACCAGTTCTTGAAAGG - Intergenic
1010568202 6:77444066-77444088 TATGTCTACCAGTTTCTGACAGG - Intergenic
1011481090 6:87794886-87794908 TTTGGCTTGCTGTTCCTGAAGGG + Intergenic
1012784614 6:103607577-103607599 TTTGGCTACCACATCCTCTAGGG + Intergenic
1013285005 6:108673637-108673659 TTTAGCTACCAAATACTGAAGGG - Intronic
1014878607 6:126693200-126693222 TTTAACTACCAGGTTCTGAAGGG - Intergenic
1017091321 6:150761921-150761943 TTTTGCTACCTCCTCCTGAAAGG - Intronic
1017153907 6:151305913-151305935 TGTGCCTTCCAGTTCCTGGAGGG - Intronic
1018118381 6:160611200-160611222 TCTGACTTCCAATTCCTGAAGGG - Intronic
1018118973 6:160616755-160616777 TCTGGCTTCCACTTCCTGAAGGG - Intronic
1018119577 6:160622301-160622323 TCTGGCTTCCACTTCCTGAAGGG - Intronic
1018120177 6:160627845-160627867 TCTGGCTTCCACTTCCTGAAGGG - Intronic
1018120782 6:160633391-160633413 TCTGGCTTCCACTTCCTGAAGGG - Intronic
1018121375 6:160638938-160638960 TCTGGCTTCCACTTCCTGAAGGG - Intronic
1018121977 6:160644485-160644507 TCTGGCTTCCACTTCCTGAAGGG - Intronic
1022106992 7:27203750-27203772 TTGGGCAACCAGTCCCTGCAGGG - Intergenic
1022278488 7:28881019-28881041 TCTGCCTATCAGTTTCTGAAAGG + Intergenic
1022780819 7:33581033-33581055 TTTGTCTACCACTTACCGAAAGG + Intronic
1023949138 7:44827774-44827796 TCTCGAGACCAGTTCCTGAAAGG + Intronic
1026441946 7:70452631-70452653 TTTGGATCCCATTTCCTAAAAGG - Intronic
1030932658 7:115544346-115544368 TTTGTCTATCTTTTCCTGAAGGG - Intergenic
1031668411 7:124514121-124514143 TTTGCCTTCCAGTACATGAAAGG - Intergenic
1035142639 7:156778106-156778128 TTTGGCTAAATGTTTCTGAATGG - Intronic
1038778100 8:30549083-30549105 TTTGGCTTCCACCTCCTGTACGG + Intronic
1039702818 8:39979076-39979098 CTGAGCTGCCAGTTCCTGAAGGG + Exonic
1043810844 8:84738050-84738072 TTTGGTTGTAAGTTCCTGAAGGG - Intronic
1046804349 8:118463560-118463582 TTCGTCTTCCAGTTCCTGCAAGG - Intronic
1048329932 8:133464543-133464565 TCTTGCTAACAATTCCTGAAGGG - Intronic
1049089673 8:140505101-140505123 CTTGGCTAACAGTGCATGAAAGG + Intergenic
1050194433 9:3066040-3066062 TTTGTGTACCAGGTCCTGCAGGG - Intergenic
1051137974 9:13944615-13944637 TTTGCCCACCAGGTCATGAAGGG - Intergenic
1053703410 9:40725114-40725136 TTTGTCTAACACATCCTGAATGG + Intergenic
1054413467 9:64848576-64848598 TTTGTCTAACACATCCTGAATGG + Intergenic
1055682518 9:78731924-78731946 CTTGGCTACCTCTTCCTGAAGGG + Intergenic
1057164455 9:92914887-92914909 TTTGGGTACCAGTTTCTTAATGG + Intergenic
1060889557 9:127179384-127179406 TCTGGCTGCCAGGTCCAGAAAGG - Intronic
1061753648 9:132798004-132798026 TTTGGCTCACAGTTCCTCACTGG + Intronic
1186717005 X:12262934-12262956 TCTGGCTAACAGGTACTGAAGGG + Intronic
1189392145 X:40585337-40585359 TTTGGCTACCACTGCTTTAAAGG + Intronic
1190605588 X:52139193-52139215 TGTGGCTACAAGTTCCTGCCTGG - Intergenic
1190642099 X:52490175-52490197 TTTGGATAACATTTCTTGAAAGG + Intergenic
1190645574 X:52522691-52522713 TTTGGATAACATTTCTTGAAAGG - Intergenic
1191895483 X:65987987-65988009 TTTTGCTACCAGTTCCTGTTAGG + Intergenic
1192536845 X:71935668-71935690 TTTGGCAACCAGCATCTGAATGG - Intergenic
1195415091 X:104611301-104611323 TTTGTCTACAAGTCCCTGATTGG + Intronic
1199743351 X:150756463-150756485 TCTGGCTGCGGGTTCCTGAAGGG + Intronic
1199787399 X:151117402-151117424 TCTGCCTATCAGTTCCTGAGTGG - Intergenic
1199880533 X:151970998-151971020 TTGGGCAGCCAGTTCCTGGATGG - Intronic
1200623307 Y:5480695-5480717 TTTGTCTATAAGTTCCTGACTGG + Intronic