ID: 1067346032

View in Genome Browser
Species Human (GRCh38)
Location 10:45439871-45439893
Sequence CAAGCTGCAGACCCTGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067346027_1067346032 9 Left 1067346027 10:45439839-45439861 CCTGGCCACAGGTGTGGGCTCCA 0: 1
1: 0
2: 4
3: 31
4: 256
Right 1067346032 10:45439871-45439893 CAAGCTGCAGACCCTGATCTGGG No data
1067346029_1067346032 4 Left 1067346029 10:45439844-45439866 CCACAGGTGTGGGCTCCAGGCAG 0: 1
1: 0
2: 0
3: 51
4: 367
Right 1067346032 10:45439871-45439893 CAAGCTGCAGACCCTGATCTGGG No data
1067346022_1067346032 27 Left 1067346022 10:45439821-45439843 CCTCTGCTACAGGAGGTGCCTGG 0: 1
1: 1
2: 2
3: 30
4: 297
Right 1067346032 10:45439871-45439893 CAAGCTGCAGACCCTGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067346032 Original CRISPR CAAGCTGCAGACCCTGATCT GGG Intronic
No off target data available for this crispr