ID: 1067346487

View in Genome Browser
Species Human (GRCh38)
Location 10:45442137-45442159
Sequence CTCAGCCAGAAATGGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067346476_1067346487 17 Left 1067346476 10:45442097-45442119 CCTTATCTCAAATACCTGGACAC 0: 1
1: 0
2: 1
3: 11
4: 190
Right 1067346487 10:45442137-45442159 CTCAGCCAGAAATGGATCCAGGG No data
1067346480_1067346487 3 Left 1067346480 10:45442111-45442133 CCTGGACACAATAGAGGGTCGGG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1067346487 10:45442137-45442159 CTCAGCCAGAAATGGATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067346487 Original CRISPR CTCAGCCAGAAATGGATCCA GGG Intronic
No off target data available for this crispr