ID: 1067348351

View in Genome Browser
Species Human (GRCh38)
Location 10:45454421-45454443
Sequence CTCCCTCAGACACGTGTGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067348351_1067348355 2 Left 1067348351 10:45454421-45454443 CCCGACACACGTGTCTGAGGGAG 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1067348355 10:45454446-45454468 TGAGGAAAACAGACACCTCCAGG 0: 1
1: 0
2: 3
3: 32
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067348351 Original CRISPR CTCCCTCAGACACGTGTGTC GGG (reversed) Intergenic
900360951 1:2288866-2288888 CTCCCCCCGCCACGTGTGTGAGG + Intronic
902308348 1:15561042-15561064 CTCCATCAGACAGGTTGGTCAGG - Intronic
904093510 1:27960725-27960747 CACCCTGAGACAGGTGTGACGGG + Intronic
913193501 1:116433391-116433413 CTGCCACTCACACGTGTGTCTGG + Intergenic
914834898 1:151198841-151198863 CTCCCTCAGACACGTCGAGCCGG - Exonic
915507597 1:156367472-156367494 CTCCCTCAGACAGGCGGGCCTGG + Intronic
918863157 1:189859767-189859789 CTCCCTCAAACACTTGCATCAGG - Intergenic
918954554 1:191188730-191188752 CTCACTCAGATACATGTGACTGG + Intergenic
922585350 1:226730195-226730217 CTCCTTCAGACCCATGGGTCTGG - Intronic
923772651 1:236950964-236950986 CTCCTTCAAACACTTTTGTCAGG + Intergenic
924510631 1:244726789-244726811 ATCCCTCAGACAGATCTGTCTGG + Intergenic
924627724 1:245709753-245709775 CTCCCTCAGTCCAGTGTTTCTGG + Intergenic
924769721 1:247068201-247068223 CTACCTCAGCCACCTGAGTCTGG - Intronic
1067348351 10:45454421-45454443 CTCCCTCAGACACGTGTGTCGGG - Intergenic
1072619199 10:97068472-97068494 CCCCTTCAGACACGGGTGCCTGG - Intronic
1073250475 10:102117921-102117943 TTCCCTCAGTCACATGTGTGGGG + Intronic
1078154498 11:8787609-8787631 CTCCCTTAAACACAGGTGTCTGG + Intronic
1079079900 11:17406878-17406900 CTCCCTCAGCCAGGTGTGACTGG - Exonic
1079370185 11:19846017-19846039 CTCCCACAGACACCTGTGCATGG + Intronic
1081104977 11:39055543-39055565 CTTCCTCAGACACGTATGAGTGG + Intergenic
1081918806 11:46753502-46753524 CTCCCTGACACAAGTATGTCTGG - Intronic
1084662233 11:70552763-70552785 CGTCCTGAGACACGTGTGTAAGG - Intronic
1088294975 11:108282974-108282996 CTCCCACACACACATGTGTATGG - Intronic
1088355911 11:108943651-108943673 GTCCCTCAGACACATATGTTAGG - Intergenic
1089775056 11:120830241-120830263 ATCCCTGAGACACGTGTCTCTGG + Intronic
1091399173 12:172236-172258 CTCCTCCAGACACGGGTGTGTGG - Intronic
1093406517 12:18811392-18811414 CCAACTCAGACACATGTGTCAGG - Intergenic
1097302065 12:58029465-58029487 CTCTCTGAGTCAGGTGTGTCTGG + Intergenic
1097844474 12:64352331-64352353 CTCCCTCAGAGGCCTGTCTCAGG - Intronic
1098290692 12:68954884-68954906 CTGCTGCAGACACCTGTGTCTGG - Intronic
1099561184 12:84175538-84175560 CTGCCTCAGAAAAGTGTGTGGGG + Intergenic
1102562634 12:113773355-113773377 CTCCGTCAGACACAAATGTCTGG - Intergenic
1104423972 12:128659586-128659608 CTCCCTCAGAGACAGGTGGCAGG + Intronic
1116043754 14:39717612-39717634 CCTGCTCAGACACCTGTGTCAGG - Intergenic
1118905573 14:70020943-70020965 CTCCCTCCAACACGTGTTTCTGG - Intronic
1121215498 14:92244584-92244606 ATCCCTCACACCAGTGTGTCAGG - Intergenic
1121611734 14:95285582-95285604 CTCCCCTAGACACGTATGACAGG + Intronic
1125356413 15:38821243-38821265 CACCCTCAGGCATGTGGGTCTGG + Intergenic
1130060529 15:80566582-80566604 TTCCCACAGACACGTCTGGCAGG - Intronic
1133394376 16:5434277-5434299 CTCCCTCTGATGCGTGTGTCTGG - Intergenic
1148664726 17:49365814-49365836 ATCCCTCAGACAGATGTGTGAGG - Intergenic
1152277888 17:79368733-79368755 CTCCCGGACACCCGTGTGTCTGG - Intronic
1152784461 17:82240707-82240729 GTCCCTCAGGCATGTCTGTCCGG - Intronic
1153004898 18:489347-489369 CTTCCTGAGACAAGTGTGTGTGG - Intronic
1153556252 18:6316841-6316863 CTCCCCCAGCCACCTCTGTCAGG + Intronic
1157559977 18:48639064-48639086 CTGCCACAGACATGTGTGCCTGG + Intronic
1157670576 18:49525072-49525094 TTCCCCCAGACATGTGGGTCTGG + Intergenic
1162354783 19:10175832-10175854 CTCCATCAGAAAGGTGTGTGAGG - Intronic
1166685521 19:44793906-44793928 CTCCCTCAGACCCAGGAGTCCGG - Intronic
1166802436 19:45466756-45466778 CTCCCTGAAAAACCTGTGTCTGG - Intronic
1167152544 19:47718617-47718639 CTCCCTCAGACCCCAGGGTCTGG - Intronic
1167152572 19:47718688-47718710 CTCCCTCAGACCCAGGAGTCCGG - Intronic
1167152610 19:47718795-47718817 CTCCCTCAGACCCAGGAGTCTGG - Intronic
1167257849 19:48442038-48442060 CTCCCTCAGACCCTGGTGTCCGG - Intronic
1167286077 19:48599586-48599608 CTCCCTCAGACTGGGGAGTCAGG - Intergenic
1167327967 19:48836785-48836807 CTCCCTCAGACCCAGGAGTCAGG + Intergenic
1167327993 19:48836858-48836880 CTCCCTCAGACCCAGGAGTCAGG + Intergenic
1167342064 19:48922078-48922100 CTCCCTCAGACCCAGGAGTCCGG - Intronic
1167352230 19:48982611-48982633 CTCCCTCAGACCCAGGAGTCTGG + Intronic
1167354346 19:48993996-48994018 CTCCCTCAGACCCAGGAGTCAGG - Intronic
1167425421 19:49427628-49427650 CTCCCTCAGACTCAGGAGTCCGG - Intronic
1167432687 19:49463132-49463154 CTCCCTCAGACCCAGGAGTCTGG - Intronic
1167432712 19:49463206-49463228 CTCCCTCAGACCCAGGAGTCTGG - Intronic
1167432807 19:49463461-49463483 CTCCCTCAGACCCAGGAGTCTGG - Intronic
1167432875 19:49463642-49463664 CTCCCTCAGACCCAGGAGTCTGG - Intronic
1167432902 19:49463716-49463738 CTCCCTCAGACCCAGGAGTCTGG - Intronic
1167560885 19:50226054-50226076 CTCCCTCAGACCCAGGGGTCTGG - Intronic
1167560997 19:50226351-50226373 CTCCCTCAGACCCAGGGGTCTGG - Intronic
1167597657 19:50435896-50435918 CTCCCTCAGACCCAGGAGTCCGG - Intronic
1167669148 19:50839491-50839513 CTCCCTCAGACCCAGGAGTCTGG - Intergenic
1167693670 19:51001998-51002020 CTCCCTCAGACCCAGGAGTCTGG - Intronic
1167752118 19:51387607-51387629 CTCCCTCAGACCCAGGAGTCCGG - Intronic
1168149236 19:54435988-54436010 CTCCCTCAGACCCAGGAGTCCGG - Intronic
1168254463 19:55158028-55158050 TTCCCTCAGACTCAAGTGTCTGG + Intronic
1168295282 19:55374968-55374990 CTCCCTCAGACCCAGGAGTCCGG + Intergenic
1168295345 19:55375126-55375148 CTCCCTCAGACCCAGGAGTCCGG + Intergenic
1168295389 19:55375238-55375260 CTCCCTCAGACCCAGGAGTCTGG + Intergenic
1168562940 19:57398352-57398374 CTCCATCACAAATGTGTGTCAGG - Intronic
936526865 2:113247222-113247244 CTCCCTCTGAAAAGTGTGTAAGG + Intronic
937976989 2:127588452-127588474 CTCCCTCAGAAACTTGTTTTTGG - Exonic
940954551 2:159712903-159712925 CTTCCTCAGGGACGTGTGGCGGG + Intronic
943073755 2:183171638-183171660 CTCCCTCAGGCAGGTGTCACAGG + Intergenic
948578277 2:238967887-238967909 CTCCCTCAGCCTCCTGTCTCTGG + Intergenic
948888699 2:240896640-240896662 TCCCCTCAGACACCTGTGCCCGG + Intronic
948961240 2:241339741-241339763 TTCCCTCAGATACCTGTGTGGGG + Intronic
1170432710 20:16291400-16291422 CTTCCTTGGACACATGTGTCTGG + Intronic
1175976113 20:62711233-62711255 CTCCCACAGACACTGGTGGCAGG + Intronic
1176666025 21:9688559-9688581 CTCCCTCAGACCCATGAGGCAGG + Intergenic
1179498597 21:41791434-41791456 CTCCTTCAGCCTTGTGTGTCTGG + Intergenic
1183036428 22:35144204-35144226 CTTCCTCAGACAGTTGTGTTAGG - Intergenic
1183327702 22:37203411-37203433 TCCCCCCACACACGTGTGTCTGG - Intergenic
954796631 3:53164797-53164819 CTCCCACAGACAGGAGGGTCAGG + Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
959220881 3:103517826-103517848 CTCCCTCAAATATGTGTTTCAGG - Intergenic
965466254 3:169034153-169034175 CTCTCTCAGACACTTGTCTTAGG + Intergenic
968935153 4:3605890-3605912 GTCCCTCAGACACCTGGGACTGG + Intergenic
972938151 4:44165540-44165562 CTCCCTCACACAAGAGTCTCAGG - Intergenic
974074359 4:57155168-57155190 CTCCCTCTGTCATGTGTCTCAGG - Intergenic
982206526 4:153001097-153001119 TTCCCTCAGGCACGTGGGCCAGG + Intergenic
989715147 5:44454235-44454257 CTCCCTCAGAGGCCTGTGTAAGG + Intergenic
992993037 5:82304964-82304986 CTTCCTCAAAGATGTGTGTCAGG - Exonic
997013248 5:129904106-129904128 AGCCCCCAGACACGAGTGTCGGG + Intergenic
1000341196 5:160278577-160278599 TGCCCTCAGACACGTGGGTGGGG + Intronic
1019206268 6:170364649-170364671 CTCCCTCTGACACCTCTCTCTGG + Intronic
1019267603 7:127150-127172 CTTCCTCAGACACATGAGCCAGG - Intergenic
1019283409 7:211568-211590 CTCCCTAGGACCCGTTTGTCAGG + Intronic
1028563672 7:92204383-92204405 CTTCCACAGACAGGGGTGTCAGG + Intronic
1031024090 7:116661706-116661728 CTCCCTCAGACCCGTGAGATAGG + Intergenic
1041332946 8:56748212-56748234 CTCCCCCAGACAGGACTGTCTGG + Intergenic
1054455030 9:65426086-65426108 GTCCCTCAGACACCTGGGACAGG - Intergenic
1057036088 9:91812567-91812589 CCCCCACACACACGTGTGTGTGG + Intronic
1057978142 9:99628796-99628818 CTCCCTCAGACACTCTAGTCTGG - Intergenic
1059875499 9:118629975-118629997 CTGCCTCAGACACCTCTGCCAGG + Intergenic
1060146181 9:121254446-121254468 CTCCCTCAGACTCCTGTCTCCGG + Intronic
1061400249 9:130364667-130364689 CTCCCTCAGGCACATGGGTGGGG - Intronic
1061505902 9:131031746-131031768 CTCCCCCAGACATGTTTGTAGGG + Intronic
1203660073 Un_KI270753v1:33202-33224 CTCCCTCAGACCCATGAGGCAGG - Intergenic
1186951869 X:14635408-14635430 TTCCCTCAGCCACATGTGTGTGG - Intronic
1190491180 X:50983843-50983865 CTCCCTCAGAGGCCTGTGTAAGG - Intergenic
1194713162 X:97259640-97259662 CCCCATCAGACACATGAGTCTGG - Intronic
1195072561 X:101294232-101294254 CTCCCTGAGACACTTTTGTCAGG - Intergenic
1196911178 X:120485950-120485972 CGCCTTCAGGCACGTGGGTCTGG + Intergenic