ID: 1067348659

View in Genome Browser
Species Human (GRCh38)
Location 10:45456303-45456325
Sequence GCCTCTCCTTTCTGTCTCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 0, 2: 2, 3: 62, 4: 573}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067348659_1067348660 -8 Left 1067348659 10:45456303-45456325 CCTGGGAGACAGAAAGGAGAGGC 0: 1
1: 0
2: 2
3: 62
4: 573
Right 1067348660 10:45456318-45456340 GGAGAGGCTGACCTATTCTCAGG 0: 1
1: 0
2: 2
3: 18
4: 281
1067348659_1067348663 4 Left 1067348659 10:45456303-45456325 CCTGGGAGACAGAAAGGAGAGGC 0: 1
1: 0
2: 2
3: 62
4: 573
Right 1067348663 10:45456330-45456352 CTATTCTCAGGAGCTGGCTATGG 0: 1
1: 0
2: 0
3: 7
4: 131
1067348659_1067348661 -2 Left 1067348659 10:45456303-45456325 CCTGGGAGACAGAAAGGAGAGGC 0: 1
1: 0
2: 2
3: 62
4: 573
Right 1067348661 10:45456324-45456346 GCTGACCTATTCTCAGGAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 92
1067348659_1067348666 30 Left 1067348659 10:45456303-45456325 CCTGGGAGACAGAAAGGAGAGGC 0: 1
1: 0
2: 2
3: 62
4: 573
Right 1067348666 10:45456356-45456378 GACAGTGCCTGCCCGGCCAGAGG 0: 1
1: 0
2: 0
3: 14
4: 170
1067348659_1067348665 23 Left 1067348659 10:45456303-45456325 CCTGGGAGACAGAAAGGAGAGGC 0: 1
1: 0
2: 2
3: 62
4: 573
Right 1067348665 10:45456349-45456371 ATGGCTGGACAGTGCCTGCCCGG 0: 1
1: 0
2: 2
3: 23
4: 240
1067348659_1067348664 8 Left 1067348659 10:45456303-45456325 CCTGGGAGACAGAAAGGAGAGGC 0: 1
1: 0
2: 2
3: 62
4: 573
Right 1067348664 10:45456334-45456356 TCTCAGGAGCTGGCTATGGCTGG 0: 1
1: 0
2: 1
3: 19
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067348659 Original CRISPR GCCTCTCCTTTCTGTCTCCC AGG (reversed) Exonic
900409047 1:2504651-2504673 GCCTCCCCTTCCGGCCTCCCTGG + Exonic
900421797 1:2558943-2558965 GGTTCCCCTTTCTGTCTGCCTGG - Intronic
900630656 1:3633435-3633457 GCCTCTCCTTCCCGCCGCCCCGG - Exonic
900808896 1:4786222-4786244 GCCTCTCCCTTCTGTGTGCAAGG - Exonic
900896625 1:5487269-5487291 GGTTCTCCTTCCTGTCCCCCTGG + Intergenic
901273305 1:7970601-7970623 CCCTCCCATTTCTTTCTCCCTGG + Intronic
901339314 1:8481025-8481047 GCATCTCCTTCCTGTTTCCTAGG - Intronic
902645203 1:17793000-17793022 GCCCCTGCTTTCTCTCTCCCAGG - Intronic
903260978 1:22131824-22131846 GCCCCTCCTTCCTATCTACCAGG + Intronic
903350455 1:22713471-22713493 GCCTGTCCTGCCTGTCTCCTGGG + Intronic
903382861 1:22909000-22909022 CCCTCCTCTTTCTGTCTCCCAGG + Exonic
904540244 1:31227916-31227938 GCCCCACCTTCCTGTCCCCCTGG + Intronic
904586005 1:31581032-31581054 GCCTCTCCTATCCTTCTCCCTGG - Intronic
904908392 1:33915303-33915325 CCCTCTCCTTTATGGATCCCTGG - Intronic
905004177 1:34696979-34697001 GCCTCCCCATTTTGTCTCTCAGG - Intergenic
905072440 1:35238859-35238881 GTCTCCCATTACTGTCTCCCAGG - Intergenic
905209175 1:36361683-36361705 GGCTCTCCTCTCTGTCTCTGTGG - Intronic
906140732 1:43532017-43532039 GTCTCTCGATTCTGTCTCCCTGG + Intronic
906263020 1:44407373-44407395 GCCTCCTCTTTCCGTCTCGCGGG + Intronic
907901517 1:58745913-58745935 CCCTCTCCCTTCTCTCTCCCTGG + Intergenic
908323344 1:62999629-62999651 GTCTCTCTTTTTTTTCTCCCTGG + Intergenic
908408396 1:63837793-63837815 GAATCTCGTTTCTGTCACCCAGG - Intronic
909251663 1:73364981-73365003 TCCTCTTCTTTCTCTCTTCCTGG - Intergenic
909692172 1:78421094-78421116 TCCTTTCCTCTCTGTCACCCAGG + Intronic
910050450 1:82967565-82967587 AATTCTCCTTTCTGTCTCCATGG + Intergenic
910418464 1:87028063-87028085 GCCTCCCTTTCCTGTCTCACAGG + Intronic
911127168 1:94351415-94351437 CCCTCTCTTTTGTGTCTCTCAGG - Intergenic
912166478 1:107047500-107047522 GAATCTCCTTTCTGTGACCCAGG + Intergenic
912869537 1:113291374-113291396 CCCTCTCCTGTCTGTTTCCTTGG - Intergenic
913209540 1:116571182-116571204 GCGCCTCCTTCCTGTGTCCCCGG + Intergenic
913328236 1:117646377-117646399 CCCTTTCCGTTCTGGCTCCCTGG + Intergenic
914444715 1:147740185-147740207 GTCTCTCCTTTCTGTGGGCCTGG - Intergenic
914901601 1:151714095-151714117 TCATCTCCCTTCTGTCTCCCAGG - Intronic
914950936 1:152112892-152112914 GGCTCTCCTTTCCGTCACACCGG + Exonic
915312589 1:155011828-155011850 GCCTCCCCCTTCTTTCTGCCAGG - Intronic
915907147 1:159887275-159887297 ACCTCTGATTTCTGTCTCTCAGG - Intronic
916006547 1:160666256-160666278 GTCTCTCCATTCTGGCTCCCAGG - Intergenic
916059185 1:161087151-161087173 GACTCTCCTTAATGGCTCCCAGG - Intronic
916072113 1:161176481-161176503 GCCTCACATCTCTGTCCCCCCGG - Exonic
916688482 1:167169388-167169410 GCCTATTCATTCTGTCTCTCTGG - Intergenic
916885107 1:169059863-169059885 GTCTCTCCTTTGTGTGCCCCTGG - Intergenic
918028599 1:180779673-180779695 TTCTTTCCTTTCTGCCTCCCGGG - Intronic
918929940 1:190842202-190842224 TCTTCTCCTTTCTGGCTGCCTGG - Intergenic
918951293 1:191143013-191143035 GCCTCTCTATTCTGTCTCATTGG + Intergenic
919743548 1:200994734-200994756 GCGTCCCCACTCTGTCTCCCTGG - Intronic
919849790 1:201664894-201664916 ATCTCTCCTTTCTGTGTCCTTGG + Intronic
920225402 1:204434862-204434884 TCTTCTCCTTTCTTTCTCCTAGG + Intronic
920368767 1:205463827-205463849 ACCACTTCTGTCTGTCTCCCTGG + Intergenic
920540171 1:206772233-206772255 TCCTGTCCTTTCTCTCTTCCTGG - Intronic
920574806 1:207051506-207051528 GACTGGCCTTTCTGCCTCCCTGG + Intronic
920719677 1:208375411-208375433 CACTCTTCTTTCTGTCTCCCTGG - Intergenic
921068898 1:211642847-211642869 GCCTCTCCTCCCTGCTTCCCTGG - Intergenic
921080578 1:211735837-211735859 GCCTGCCCTGTCTGCCTCCCGGG - Intergenic
922406856 1:225323226-225323248 TCCTCTTCCTTCTGTCCCCCAGG - Intronic
922436474 1:225612381-225612403 GAATCTGCTTTCTGTCTCCATGG - Intronic
922768432 1:228168469-228168491 GTCTGTCCTTTCTGTGTCTCAGG + Intronic
922955884 1:229599473-229599495 TCCTCTCCTCTCTGTCTCTATGG + Intronic
922958999 1:229628985-229629007 GCCTCCCCTTTGTTTCACCCTGG - Intronic
923322334 1:232847170-232847192 GTGTCTCCTTTCTCTCTCACAGG - Intergenic
923587708 1:235289697-235289719 GAATCTCCTTCCTGTCCCCCAGG - Intronic
924361466 1:243245836-243245858 TCCTCTCCGCTCAGTCTCCCAGG - Intronic
1063412779 10:5849479-5849501 GCCTCGCCTTTCTAGCTCTCTGG + Intergenic
1063608038 10:7540122-7540144 CCCTCTCCTTTTTATCTCCAGGG - Intergenic
1063609941 10:7553611-7553633 TCCCCTCCTTTCTTTCTCGCTGG + Intergenic
1064005781 10:11697846-11697868 GCTTCTGCTTTCTGTCTCCATGG + Intergenic
1064332976 10:14411053-14411075 TCCTCTCCTTTCTATTTCTCTGG + Intronic
1064540321 10:16398357-16398379 GCCTCTGCCTCCTGCCTCCCAGG - Intergenic
1064870559 10:19932365-19932387 GCCTTTCCTTTCTATATACCAGG + Intronic
1066067550 10:31773394-31773416 GCCTCTGCTTTCCGACTTCCTGG - Intergenic
1066959539 10:42207862-42207884 ATCCTTCCTTTCTGTCTCCCTGG + Intergenic
1067044738 10:42979099-42979121 TCCTCTCCTTCCTCTCTTCCAGG - Intergenic
1067081453 10:43214871-43214893 GCCTCTCCGGGCTGTCTCCCTGG - Intronic
1067094757 10:43293049-43293071 GCCTCTTCCTTATGTCTCCCTGG - Intergenic
1067348659 10:45456303-45456325 GCCTCTCCTTTCTGTCTCCCAGG - Exonic
1067781605 10:49211551-49211573 GCCCATCCTGTCTGTCTCTCAGG + Intergenic
1069742967 10:70697187-70697209 GCCTCTCCTTTCTCCTTCCAAGG - Intronic
1070314648 10:75298383-75298405 TACTCTCCTTTCTGTCTCTATGG + Intergenic
1070538068 10:77394167-77394189 GCCACTCATCTCTGGCTCCCAGG - Intronic
1070909968 10:80109442-80109464 GTCTCTCCTCTCTATCACCCAGG + Intergenic
1071828378 10:89348270-89348292 TCCTCTCCTTTATGCCTCCCTGG + Intronic
1073154434 10:101335218-101335240 CTCTGCCCTTTCTGTCTCCCTGG + Intergenic
1073292145 10:102418723-102418745 GCCTCTCCTCTGTCTCTCCTCGG - Exonic
1073323850 10:102631323-102631345 CCCTCTCCTTTCTGGCATCCTGG + Exonic
1075285211 10:121178829-121178851 TCTTCTCCACTCTGTCTCCCAGG + Intergenic
1075327770 10:121548173-121548195 TCCTCTCCTTTCTGGTTCTCTGG - Intronic
1075508855 10:123052393-123052415 GACTCTGCTTCCTGTCTCCATGG + Intronic
1075711109 10:124530912-124530934 GCCCGTCCTTCTTGTCTCCCTGG + Intronic
1076023073 10:127090109-127090131 GCTTCTCCTTTCTGGCTTCCTGG + Intronic
1076218415 10:128714071-128714093 GACTCTCCTTTCTCTCTCCCTGG - Intergenic
1076357059 10:129861016-129861038 CCCTCTCTTTCCTGTCTCCAAGG - Intronic
1076357223 10:129861891-129861913 GCCCCAGCTTGCTGTCTCCCAGG - Intronic
1076435819 10:130440621-130440643 GCCTCTCTTTTCTGTTTTCCAGG - Intergenic
1077154776 11:1086411-1086433 GCCTGTCCTGGCTGCCTCCCAGG + Intergenic
1077431375 11:2517502-2517524 GCCTCACCTCTCTGTCTGGCAGG + Intronic
1077461018 11:2709672-2709694 GGCTCTGCTTTCTATCTCCACGG + Intronic
1077480420 11:2812003-2812025 GCCTCTCGTTCCTGTCCTCCTGG + Intronic
1077486283 11:2839771-2839793 TCCCCTCTTGTCTGTCTCCCTGG - Intronic
1078234824 11:9474850-9474872 GCCTCTACTTTAAGTCTTCCAGG - Intronic
1078530578 11:12133837-12133859 GCCTCTCCTGTCTGTGTCTCAGG + Intronic
1079189189 11:18263873-18263895 TCCTCTCCTTCCTGTCTCAGAGG + Intergenic
1079777998 11:24558407-24558429 GCCTATCAGTTCTGTCTCTCTGG + Intronic
1080418586 11:32091424-32091446 GCCTCTCCTTGCTCTCGTCCGGG - Exonic
1081391021 11:42528933-42528955 GCCTCTCCTCTGTGTGTCTCAGG - Intergenic
1081876278 11:46410465-46410487 GCCCATCCTTTCTCTCTCCTGGG + Intronic
1083142274 11:60732053-60732075 GCAGCTGCTTTCTGTCTTCCTGG - Intronic
1084394148 11:68897894-68897916 CCCTCTAGCTTCTGTCTCCCAGG + Intronic
1084499222 11:69525061-69525083 GCCTCTCCTTTCAGGCCCCCTGG - Intergenic
1084594572 11:70109333-70109355 TCGTCTTCTCTCTGTCTCCCGGG - Intronic
1086355548 11:85994726-85994748 TCTTTTCTTTTCTGTCTCCCAGG + Intronic
1086551111 11:88052861-88052883 ACCTCTCATTACTGCCTCCCAGG + Intergenic
1087605581 11:100373616-100373638 GGCTCTACTTTCTCTGTCCCTGG + Intergenic
1087924528 11:103904072-103904094 ACCCCTCCTTCCTGCCTCCCTGG + Intergenic
1088504433 11:110514482-110514504 GCCTCTCATTTTTTTCTCACTGG - Intergenic
1088916351 11:114230837-114230859 CCCACTCCATTCTGTCTCCCTGG + Intronic
1089330194 11:117684022-117684044 ACCTTGCCTTTCTTTCTCCCTGG + Intronic
1089359075 11:117874556-117874578 CCCTCCCCTTCCTGCCTCCCTGG + Intronic
1089373140 11:117975675-117975697 GCCTCTTCTCCCTGTCCCCCAGG - Intergenic
1089575955 11:119443715-119443737 GACTCTCCTTTCTGTTTCATTGG + Intergenic
1089864600 11:121620638-121620660 GGCTCTACTTACTTTCTCCCAGG - Intronic
1090378016 11:126305136-126305158 GTCTCTCCTCTCTGTCACCCAGG + Intronic
1091397347 12:162097-162119 TCCTTTCCTTTCTTTCTTCCTGG + Intronic
1091398278 12:167547-167569 TCCTTTCCTCCCTGTCTCCCTGG - Intronic
1091403989 12:197602-197624 GCCTCCCCCTTCTCTCTCCTTGG - Intronic
1091547316 12:1510044-1510066 GCCTCTCCTTTCCGTTACCCAGG - Intergenic
1091613226 12:2029458-2029480 CGCTCTGCTTTCTGTCTCCGTGG + Intronic
1092832067 12:12453868-12453890 CAGTCTCCTTTCTGTCTCTCTGG + Intronic
1092925713 12:13270227-13270249 TCCTCTTCGTTCTGTCTCCAGGG - Intergenic
1094227098 12:28057864-28057886 CCCTCTCCATTGTGTTTCCCAGG - Intergenic
1094376674 12:29797696-29797718 GCTTGTCCTTTCTCTTTCCCTGG - Intergenic
1094475628 12:30838530-30838552 GGCTCTCCACTCTGTCACCCAGG - Intergenic
1094639434 12:32259604-32259626 ATCTCTCCTTTCTCTCTGCCTGG - Intronic
1095236696 12:39805119-39805141 GCCTGCCCTTGCTGTCTTCCTGG - Intronic
1095496447 12:42789552-42789574 GAGTCTCGTTTCTGTCACCCAGG + Intergenic
1095732417 12:45520597-45520619 GCCTATCAATTCTGTCTCTCTGG - Intergenic
1096452006 12:51751070-51751092 GCCTCTCAGGTCTGACTCCCTGG - Intronic
1096634364 12:52949146-52949168 TCCTGTCCTTTCTCTCTCCCCGG + Exonic
1096991724 12:55809715-55809737 GGGTCTCCCTTCTGTCGCCCAGG - Intronic
1097469240 12:59967893-59967915 GTCTCGCCGTTCTGTCGCCCAGG + Intergenic
1098186055 12:67897365-67897387 GCCTCTGCTGTCTGTCACCTGGG - Intergenic
1098210303 12:68156846-68156868 GTCTCTCCTTTCTGTTTCTGGGG + Intronic
1099012350 12:77306850-77306872 GCCTCTGCTTTTTGTTTCCGAGG + Intergenic
1100504549 12:95206665-95206687 GGGTCCCCTCTCTGTCTCCCAGG - Intronic
1100634901 12:96426245-96426267 CCCTTTACTTTCTGTCTCCATGG + Intergenic
1100796611 12:98188651-98188673 GGCTCTCCTTAATGTCTGCCTGG + Intergenic
1102259088 12:111432699-111432721 TCATCTCTTTTCTGTCTCCAGGG + Intronic
1102870742 12:116412106-116412128 GAATCTGCTTTCTGTCTCCCTGG + Intergenic
1103248284 12:119477192-119477214 ACCTCTCCTTCCTGTGTCCTGGG - Intronic
1103454298 12:121052891-121052913 GCCTCACCTTTCTGTGTGGCTGG - Intergenic
1103732140 12:123034685-123034707 TTCTGTCCTCTCTGTCTCCCAGG - Exonic
1103842591 12:123877152-123877174 GACTCTACCTTCTGTCTCCATGG + Intronic
1103956726 12:124581604-124581626 GAATCTCCTTTCTGTCTCTATGG - Intergenic
1104435614 12:128754117-128754139 GAATCTACTTTCTGTCTCTCTGG - Intergenic
1104605008 12:130181422-130181444 CACTCTGCTTTCTGTCTCTCCGG + Intergenic
1105450462 13:20494760-20494782 GCCACTGCTTGCTGTCTCCATGG - Intronic
1105765556 13:23555143-23555165 GCCTCTCCTCTGTGCCTTCCTGG - Intergenic
1105860263 13:24403899-24403921 GCCTCTCCTTTGTGGCATCCCGG + Intergenic
1106311224 13:28556263-28556285 GCCTTTTCTTTGTGTCTCCTGGG - Intergenic
1107402516 13:40083321-40083343 GTCTCTCTTCTCTTTCTCCCTGG + Intergenic
1107942951 13:45391099-45391121 GCCTCTCCTTGCTCTCGTCCGGG + Intergenic
1109274739 13:60290916-60290938 GCCTCTTATTTTTGTCTTCCTGG - Intergenic
1112358020 13:98690900-98690922 TCATCTGCTTTCTGTCTCCATGG + Intronic
1112812121 13:103230962-103230984 GCCTCACCCTGCTGTCACCCAGG - Intergenic
1114071633 14:19114032-19114054 GCCCCTTTTTTCTGTCTTCCTGG - Intergenic
1114090628 14:19285936-19285958 GCCCCTTTTTTCTGTCTTCCTGG + Intergenic
1114200008 14:20511324-20511346 GCCTCTCCTTTCCCTTACCCTGG + Intergenic
1114473704 14:22980644-22980666 GGCGCTCCATCCTGTCTCCCAGG + Intronic
1114506472 14:23218581-23218603 GCATCTCACTTCTGTCACCCAGG - Intronic
1115353013 14:32416578-32416600 GAATCTCTTTTCTGTCGCCCAGG + Intronic
1115357914 14:32468692-32468714 GTCCCTCCATTCTTTCTCCCAGG + Intronic
1115829521 14:37319834-37319856 TCCTCTTATTTCTGTCTCCATGG + Intronic
1116265638 14:42686524-42686546 CCTTCTCTTTTCTGTCTTCCAGG + Intergenic
1118455124 14:65938602-65938624 TCTTCTCCTCCCTGTCTCCCAGG - Intergenic
1118820763 14:69344142-69344164 GCCTCTTCTTTCAGCCTCCTCGG - Intronic
1118953016 14:70452136-70452158 CCCTCTCCCTTTTGTCTCTCAGG - Exonic
1119349122 14:73949887-73949909 GCCCCTGCTGTCTGTCTCCAAGG + Intronic
1119514528 14:75237546-75237568 GCCTGTTCTCACTGTCTCCCTGG + Intergenic
1119555330 14:75548291-75548313 GCCTCTGCCTGCTGCCTCCCCGG + Intergenic
1119685988 14:76631718-76631740 TCCTCTTCTCTCTGTCTCCTTGG - Intergenic
1120210009 14:81624601-81624623 GGCTGTCCGTTCTGTCTCCAAGG + Intergenic
1121087747 14:91159419-91159441 GTCTCGCCACTCTGTCTCCCAGG - Intronic
1121615653 14:95311833-95311855 GCCTCTATGTTCTGTATCCCTGG - Intronic
1122327638 14:100891929-100891951 TCCTCTCATTACTGTTTCCCAGG - Intergenic
1122381562 14:101310556-101310578 GCATCTCCTTTGTCTCTACCAGG + Intergenic
1122415375 14:101547189-101547211 TCCCCTCCATGCTGTCTCCCTGG - Intergenic
1122714384 14:103685616-103685638 CTCTCTCCTTTCTGTCTGACAGG + Exonic
1122872799 14:104648700-104648722 GCCTTTACTTTCTGTCTCTATGG - Intergenic
1202933385 14_KI270725v1_random:60852-60874 GTCCTTCCTTTCTGTCTCCCTGG - Intergenic
1124027204 15:25977549-25977571 GCCTAGCCTTTCTGTGTCACTGG + Intergenic
1124466916 15:29948497-29948519 ACTTCTCATTTCTGTCTCACTGG - Intronic
1125477746 15:40058860-40058882 GAATCTGCTTTCTGTCTCTCTGG - Intergenic
1125522425 15:40355746-40355768 TCTTCTCCTTTCTCTCACCCAGG - Intronic
1125642104 15:41239800-41239822 GAGTCTCCTCTCTGTCACCCAGG + Intronic
1126530398 15:49704056-49704078 GCGTCTCCTTCGTGTCTACCAGG + Intergenic
1127031593 15:54870600-54870622 GCTTCTCTCTTCTGTATCCCTGG - Intergenic
1127161958 15:56197882-56197904 GACTCTGCTTTCTCTCCCCCAGG + Intronic
1129149457 15:73678697-73678719 CCCTGCCCTTTCTCTCTCCCTGG - Intergenic
1129321215 15:74776129-74776151 GCCTCTAATTTCTGTCCCCCTGG - Intergenic
1129481505 15:75830196-75830218 TCTTCTCCTCTTTGTCTCCCAGG - Intergenic
1129704787 15:77787967-77787989 GCCTCTCCTGTCTCTGCCCCTGG - Intronic
1129968653 15:79758418-79758440 TCCTCTCCTCTCTGCATCCCAGG - Intergenic
1130866417 15:87936835-87936857 CCCTCTCTTATCTGTCTTCCTGG + Intronic
1131264422 15:90907148-90907170 GCCCCTCATGTCTTTCTCCCTGG + Intronic
1131283759 15:91040939-91040961 TCATCTGCTTTCTGTCTCCGTGG - Intergenic
1131806202 15:96125294-96125316 TTCTCTCCTTTCTGGCTGCCTGG - Intergenic
1132324334 15:100954823-100954845 GACTCTCCATTCTGTTTCACTGG + Intronic
1132677098 16:1125334-1125356 GCCTCTCCTCACTGTGGCCCAGG + Intergenic
1132753744 16:1471806-1471828 GCCTCTCCAGTCTGTCTGCAGGG + Intronic
1132870840 16:2115124-2115146 GCTGCTCCTTCCTGTCTGCCAGG - Intronic
1133192711 16:4146350-4146372 GACTCTGATTTCTGTATCCCTGG - Intergenic
1133262092 16:4557467-4557489 ACCACTGCTTTCTGTCTCCATGG - Intronic
1133978482 16:10617161-10617183 ATGCCTCCTTTCTGTCTCCCGGG + Intergenic
1134036582 16:11036025-11036047 ACCTCTGCTCTCTGCCTCCCAGG + Intronic
1134061747 16:11203368-11203390 GCACCTCCTGTCTGTCTCCAGGG + Intergenic
1134521690 16:14921780-14921802 GCCGCTCCTTCCTGTCTGTCAGG + Intronic
1134709360 16:16320431-16320453 GCCGCTCCTTCCTGTCTGTCAGG + Intergenic
1134716572 16:16360460-16360482 GCCGCTCCTTCCTGTCTGCCAGG + Intergenic
1134840807 16:17400128-17400150 CCCTGTCCTTCCTGTCTACCTGG - Intronic
1134950242 16:18348214-18348236 GCCGCTCCTTCCTGTCTGCCAGG - Intergenic
1134958178 16:18391699-18391721 GCCGCTCCTTCCTGTCTGCCAGG - Intergenic
1135139261 16:19907780-19907802 GTCTCTACTTTCCGCCTCCCCGG + Intergenic
1135335401 16:21597759-21597781 ACCTCTCCTTCCTGTCTCTTAGG - Intronic
1135582389 16:23639792-23639814 GACTCTCCGCTCTATCTCCCAGG - Intronic
1135717187 16:24781771-24781793 CCCTCTCCTATATGTCTCACAGG + Intronic
1136374576 16:29857867-29857889 ACCTCTCCCTCCTGCCTCCCAGG + Intergenic
1136646604 16:31624583-31624605 GGCTCTACTTTCTGTCAGCCAGG + Intergenic
1136658546 16:31731650-31731672 GGCTCTACTTTCTGTCAGCCAGG - Intronic
1137933250 16:52608597-52608619 GTCTATCCTATCTGTCTCCAGGG + Intergenic
1138100251 16:54246571-54246593 GCCCCACCTTGCTGTCTCTCAGG + Intronic
1138251486 16:55505317-55505339 GTCTCTTCTTTCTCTATCCCAGG + Exonic
1138399846 16:56736594-56736616 GCCCCTGGCTTCTGTCTCCCAGG - Intronic
1139329715 16:66177918-66177940 GCTTCTCCTCTCTCTCTCTCTGG - Intergenic
1139554109 16:67695559-67695581 GAGTCTCATTTCTGTCACCCAGG + Intronic
1140337191 16:74118700-74118722 TCCTCTCCTCTCTTTCTTCCTGG - Intergenic
1140556939 16:75932216-75932238 GCTTCTACTTCCTGTCTCCTGGG - Intergenic
1141469276 16:84227876-84227898 CCCTCTGCTTTCTGTCTCTGTGG - Intronic
1141887112 16:86899704-86899726 ACTTATCCTTTGTGTCTCCCAGG - Intergenic
1142441244 16:90098903-90098925 TCCTCTCTTTTCTGTTTCTCTGG + Intergenic
1142561114 17:809517-809539 CCCGCTCCTCTCTGCCTCCCAGG - Intronic
1142848849 17:2694738-2694760 CCCTCTTCTCTCTGACTCCCTGG + Intronic
1144055227 17:11534740-11534762 GAATCTTGTTTCTGTCTCCCTGG - Intronic
1144244547 17:13349788-13349810 CAATCTCCTTTCTGTCTCCATGG + Intergenic
1144455059 17:15412126-15412148 GCCTCTGGTTTTTGTCTCCGGGG - Intergenic
1144648774 17:16992961-16992983 TCATCTCCTTTCTGTCTTTCTGG + Intergenic
1144696417 17:17306729-17306751 CCTTCTCCTTTCTCTCTCCTTGG + Intronic
1146608964 17:34287977-34287999 CCCTCTCCTCTCTTCCTCCCTGG + Exonic
1146764868 17:35510553-35510575 TCCTCTCCTCTCTGTCTCTATGG - Intronic
1147192107 17:38743968-38743990 GCCTCCCCTTTCTGTTTCTTGGG - Intronic
1147343165 17:39767510-39767532 GCCTCTCCATTCTGTCAGCTTGG + Intronic
1147747559 17:42704463-42704485 GCCTCTACCCTCTGCCTCCCGGG - Intronic
1148764396 17:50028774-50028796 CCCTCTCCTCTCTGTCATCCTGG + Intergenic
1148897209 17:50845881-50845903 CCCTCTCCTGCCTGCCTCCCAGG + Intergenic
1149885680 17:60337853-60337875 CCGTCTCATTTCTGTCTCCCAGG - Intronic
1150361212 17:64536013-64536035 GTCTGTACTTTCTGTCTCCATGG - Intronic
1150858086 17:68772494-68772516 GGCTCTCCTTTCTATGTCACTGG - Intergenic
1151183339 17:72345533-72345555 CCCTCTTCTTTCTGCCTTCCTGG - Intergenic
1152219588 17:79055682-79055704 TCGTCTGCTTTCTGTCTCCATGG - Intergenic
1152405365 17:80095241-80095263 GCCCCTCTGTCCTGTCTCCCAGG + Exonic
1152736492 17:81999897-81999919 CCCTCTGTTTTCTGTCCCCCTGG + Intronic
1152908779 17:82985015-82985037 GCCTCCCCTTTGGGCCTCCCTGG + Intronic
1153825605 18:8871473-8871495 GCTTCTACTTGCTGTCTCCTGGG + Intergenic
1154115823 18:11612648-11612670 GTCTCTCCTCTCTGTCTCTATGG + Intergenic
1154120267 18:11646871-11646893 GTCTCTCCTCTCTGTCTCTATGG + Intergenic
1154453488 18:14500867-14500889 GACTCGCCTTTCTGTGGCCCTGG - Intergenic
1154966644 18:21364440-21364462 TCTTCTCCTTTCTTACTCCCTGG - Intronic
1155588770 18:27400311-27400333 CCCTCTCCATTTTCTCTCCCTGG + Intergenic
1155693013 18:28650152-28650174 GCCCCTCTTTTCTCTTTCCCGGG + Intergenic
1155769962 18:29683927-29683949 GGCTCTCTTTTCTGTCCCACTGG - Intergenic
1156045419 18:32872005-32872027 TCCCCTTCTTTCTGTCTCCTTGG + Intergenic
1156499133 18:37545838-37545860 CCCTCTTCTTCCGGTCTCCCAGG + Intronic
1157519975 18:48338774-48338796 GCATCTCCTTTCTCTTTCCTGGG - Intronic
1157777060 18:50403977-50403999 GCCCCTCCTTTCTGGCTTCCCGG - Intergenic
1158716582 18:59885712-59885734 CCCTCTCCTTTCAGGGTCCCAGG - Intergenic
1158968629 18:62645218-62645240 GCCTCTCTTCTCTCTTTCCCAGG + Intergenic
1160449824 18:78955010-78955032 GCCTGTGGTTTCTGTCTCTCGGG + Intergenic
1160558173 18:79739604-79739626 GCCTCTCCATTCTGGCTCCTCGG + Intronic
1160851630 19:1195565-1195587 GCCTCTCCCATCTGTAACCCAGG + Intronic
1160851654 19:1195639-1195661 GCCTCTCCCATCTGTAACCCAGG + Intronic
1160851778 19:1196171-1196193 GCCTCTCCCATCTGTAACCCAGG + Intronic
1160852054 19:1197379-1197401 GCCTCTCCCATCTGTAACCCAGG + Intronic
1160852078 19:1197453-1197475 GCCTCTCCCATCTGTAACCCAGG + Intronic
1160852202 19:1197985-1198007 GCCTCTCCCATCTGTAACCCAGG + Intronic
1161222827 19:3125909-3125931 TCCTTCCCTTCCTGTCTCCCAGG - Intergenic
1161384541 19:3983968-3983990 GCCTCTCCATCCTGTCTCGCTGG + Intronic
1161404535 19:4084183-4084205 GCCTCTCCTGTCCGCCTGCCAGG + Intergenic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1161803602 19:6429762-6429784 GCGTCTCCTTGCTGGCTCCCTGG - Exonic
1162217210 19:9146450-9146472 GTGTCTCATTTCTGTCACCCAGG + Intronic
1163082379 19:14953294-14953316 GCCTCCTCTCTCTCTCTCCCAGG + Intronic
1163417404 19:17194997-17195019 TGCTCTCCTTTTTGTCTTCCAGG - Exonic
1163825258 19:19519882-19519904 CCCACTCCCTTCTGTCTGCCTGG + Intronic
1164080602 19:21858708-21858730 GCCTCTCCTCTGTTTCTACCAGG - Intergenic
1164229190 19:23273303-23273325 CCCTTTCCTTTATGTCTCTCAGG + Intergenic
1164289516 19:23854532-23854554 GGCCCTGCTTTCTGTTTCCCTGG + Intergenic
1165161495 19:33819594-33819616 CCCTCTCCTTTGTGTGTCCCCGG - Intergenic
1165356544 19:35307939-35307961 TCCCCTCCTTTCTGGCTTCCAGG - Intronic
1165920426 19:39294245-39294267 ACTTCTCCTTTCTGTCCCTCTGG - Intergenic
1166088684 19:40493951-40493973 GCATCTCCCTTCTGCCTCACAGG + Intronic
1166524593 19:43503258-43503280 GTCTCTCCTGTCTGTCTATCTGG + Intronic
1167017003 19:46847631-46847653 GAGTCTCCTTTCTGTCTCTGTGG + Intronic
1167124804 19:47542185-47542207 GAGTCTCCTTTCTGTCTCTGTGG - Intronic
1167141422 19:47653546-47653568 GCATCTACTTTCGGTCTCTCTGG + Intronic
1167497815 19:49829796-49829818 ACTTCTCCATTGTGTCTCCCCGG + Exonic
1167668867 19:50838606-50838628 GCCTCTCCTTTCTCAGACCCAGG - Intergenic
925609305 2:5691314-5691336 GCCGCTCCTTTCTCCTTCCCAGG - Intergenic
925852498 2:8096229-8096251 GGCTCTCTTATCTGTCTACCTGG + Intergenic
925976996 2:9148667-9148689 CTCCCTCCTTTCTGTTTCCCTGG + Intergenic
926118963 2:10230783-10230805 GCCCCCACTTTCTGTGTCCCAGG - Intergenic
926936856 2:18094594-18094616 GTCTCTGATTTCTTTCTCCCTGG + Intronic
927182387 2:20455892-20455914 ACCTCTGCCTCCTGTCTCCCAGG - Intergenic
927314802 2:21669379-21669401 TACTCTCCTTTCTTTTTCCCTGG + Intergenic
928066800 2:28173435-28173457 TTCTCTCCCTTCTCTCTCCCGGG - Intronic
928130877 2:28649218-28649240 GCCTGCCCTTCCTGTCTTCCTGG - Intergenic
928904344 2:36355365-36355387 GCCTCGCCCTCCTGGCTCCCAGG + Intergenic
929119963 2:38476492-38476514 CCCTCTCCTGTATGTCTCCTGGG - Intergenic
930411254 2:51028357-51028379 CCCTTACCTTTCTGTCTCTCGGG - Exonic
932277846 2:70464789-70464811 TGGTCTCCTCTCTGTCTCCCTGG + Intronic
933439679 2:82296943-82296965 ACCTCCCCTTTCTCTCTCTCTGG - Intergenic
933693777 2:85199937-85199959 TCCTCTACTTTCTGTCTCCATGG + Intronic
933743158 2:85550754-85550776 TCCTCTTTTTTCTGTCTTCCGGG - Intronic
934325369 2:92009229-92009251 ATCCTTCCTTTCTGTCTCCCTGG - Intergenic
934813609 2:97305395-97305417 ACCTCACCTTTCTTTCTCTCTGG + Intergenic
934824086 2:97403085-97403107 ACCTCACCTTTCTTTCTCTCTGG - Intergenic
935661495 2:105470697-105470719 CTGTCTCCTTTCTGTCACCCAGG + Intergenic
935800041 2:106686670-106686692 GCCTCTTCTTTCTGGCCTCCAGG + Intergenic
936013879 2:108943302-108943324 GCCTCCCCTCTGTTTCTCCCAGG - Intronic
936062154 2:109301949-109301971 GCCTCTCCTGCATGTCTTCCTGG + Intronic
936235978 2:110743092-110743114 CCATCTACTTTCTGTCTCCATGG + Intronic
936922056 2:117698900-117698922 TCCTCTCCTTTCTCTCTTACAGG + Intergenic
937070701 2:119060988-119061010 GCCCCAGCTTTCTGTCTGCCTGG + Intergenic
937845456 2:126574147-126574169 GCCTCTCCTCACTGCTTCCCTGG + Intergenic
938019190 2:127892298-127892320 GCCTCTTCCTTCTGGGTCCCAGG - Intergenic
938080024 2:128364920-128364942 GCCACTCCTTCCTGCCCCCCTGG + Intergenic
938267053 2:129935192-129935214 GCCTCTGCCTTCTGTGTTCCTGG + Intergenic
938485890 2:131707594-131707616 GCCCCTTTTTTCTGTCTTCCTGG - Intergenic
938581076 2:132647108-132647130 GGCTTCCCTGTCTGTCTCCCAGG + Intronic
938605068 2:132883682-132883704 CCCTCTGCTTTCCATCTCCCTGG + Intronic
939115437 2:138055285-138055307 TTCTCTCCTTTCTGTTACCCAGG - Intergenic
939763472 2:146214645-146214667 GACTTTCCCTTCTGTCTCTCTGG - Intergenic
939816311 2:146901593-146901615 TTCTTTCCTTTCTGTCGCCCAGG + Intergenic
941425255 2:165336535-165336557 TCATCTCCTTTCTGTCTCTATGG - Intronic
941754513 2:169170660-169170682 GCCTTTCCTTTCCAGCTCCCCGG - Exonic
941995240 2:171595736-171595758 TCTTCTCCTTCCTTTCTCCCTGG - Intergenic
942043948 2:172088268-172088290 CCGTCTCCTTCTTGTCTCCCCGG + Exonic
942397676 2:175568746-175568768 GTCACTCCTTTCTGTTTCTCAGG - Intergenic
942446040 2:176079841-176079863 CTCTCTCTTTTCTGGCTCCCGGG - Exonic
942547117 2:177076666-177076688 GCCACTGCTTGCTGTTTCCCTGG + Intergenic
943388903 2:187236752-187236774 GCCTCTCCTTTAGGTCAGCCTGG - Intergenic
944456097 2:199896157-199896179 CCCTCTCTTGTCTGTCACCCAGG - Intergenic
944780341 2:203011016-203011038 GTCCCTTCTTTCTGTCTCCTAGG - Intronic
945257119 2:207812047-207812069 GCCTCCCCTTTCCCTCTCTCTGG - Intergenic
945331411 2:208543497-208543519 GCCTCTCCCTTTTCTCTCTCTGG + Intronic
945955310 2:216081451-216081473 GCTGCTCTCTTCTGTCTCCCTGG + Intronic
946153139 2:217789633-217789655 TCATCTGCCTTCTGTCTCCCAGG - Intergenic
947638183 2:231691053-231691075 GATTCTCCTGCCTGTCTCCCTGG + Intergenic
947838204 2:233190042-233190064 GCCTCTCCTTTCCTCATCCCAGG + Intronic
948027595 2:234790329-234790351 TCCTCTCATTTCTTTCTCCTTGG - Intergenic
948583873 2:239006344-239006366 GCCTGTTCTTCCTGTCTCACTGG + Intergenic
1168856509 20:1012943-1012965 GCCTCTCCTTCCCATCTCCTTGG - Intergenic
1169352549 20:4880911-4880933 GCTTCTCCCTCATGTCTCCCAGG - Intronic
1169375402 20:5062950-5062972 GCATCTCCTCTCTCTGTCCCTGG - Intergenic
1170836977 20:19892967-19892989 GCTTCTGCTTTTTCTCTCCCTGG - Intronic
1171182007 20:23097960-23097982 GGCTGTCCTTTCTGCCTCTCTGG + Intergenic
1172670858 20:36633628-36633650 CCCACTCCTTTCTCTCTCCAGGG - Exonic
1172944138 20:38674749-38674771 GCCCCCCCTTCCTGTTTCCCTGG + Intergenic
1172954009 20:38742491-38742513 GGATATCCTTTCTGTTTCCCAGG + Intergenic
1173476468 20:43363369-43363391 CTCTCTCCCTCCTGTCTCCCTGG - Intergenic
1173644328 20:44624173-44624195 GCCTCTCCATTCCTTCTCACAGG + Intronic
1174109364 20:48187472-48187494 GCCTTCCCTTCCTGTCTCCCTGG - Intergenic
1174482351 20:50840426-50840448 GCCTCTCCCATCTGTCTATCTGG - Intronic
1175537259 20:59723320-59723342 GAATCTACTTTCTGTCTCTCTGG + Intronic
1175942489 20:62543972-62543994 GAATCTGCTTTCTGTCTCCATGG + Intergenic
1176058050 20:63159357-63159379 GCCTCTACCTTCTGTCTCTTTGG - Intergenic
1176594781 21:8683007-8683029 GTCCTTCCTTTCTGTCTCCCTGG - Intergenic
1176820694 21:13652438-13652460 GACTCGCCTTTCTGTGGCCCTGG + Intergenic
1176958773 21:15136419-15136441 GACTCAGCTTTCTGTCTCCAGGG + Intergenic
1177440982 21:21123369-21123391 GTCTCTTCGCTCTGTCTCCCAGG - Intronic
1178880544 21:36446814-36446836 GCCTCTTCCTCCTGTCTCGCTGG + Intergenic
1178894527 21:36548032-36548054 GCCTCTCAACTCTGGCTCCCGGG + Intronic
1179391380 21:40995079-40995101 GCTTCTGCTTTCTGTCTGCAAGG + Intergenic
1179726970 21:43346282-43346304 GCCTGTCCTTCCTGTCCTCCTGG + Intergenic
1180049383 21:45324390-45324412 ACCCCTCATTTCTGACTCCCTGG - Intergenic
1180277638 22:10660177-10660199 GTCTGTCCTTCCTGTCTCCCTGG - Intergenic
1180490077 22:15836363-15836385 GCCCCTTTTTTCTGTCTTCCTGG - Intergenic
1180584871 22:16878999-16879021 GTCCTTCCTTTCTGTCTCCCTGG - Intergenic
1181927087 22:26368553-26368575 GACTCTGCTTTCTGTCTCTATGG - Intronic
1182066988 22:27437985-27438007 GCCTCTCTGTTCTGCATCCCAGG - Intergenic
1182405734 22:30128035-30128057 GCCTCTCCAGTTTGTCTTCCAGG + Intronic
1182584494 22:31336361-31336383 GCCTTTCCTTTCCATTTCCCTGG - Intronic
1182962386 22:34488063-34488085 GCTTTTCCTTTCTGACTCCCTGG - Intergenic
1183348911 22:37323848-37323870 GCCTTTCCTCTCCGTCTGCCTGG + Intergenic
1183776229 22:39968020-39968042 GCATCTCTGTTCTTTCTCCCAGG + Exonic
949694341 3:6677018-6677040 TCCTCCCCTTTCTGTCTTCCTGG + Intergenic
949707341 3:6834335-6834357 GCTTCTTCTCTCTGTCGCCCAGG - Intronic
949826485 3:8170765-8170787 TCCTTTCCTGTCTGTCTTCCAGG + Intergenic
949873076 3:8606015-8606037 GCCTCACTTTTCTCCCTCCCAGG + Intergenic
950085572 3:10255036-10255058 TCCTTTCCTGTCTGTCACCCAGG + Intronic
950714287 3:14836727-14836749 GCCTCTCCCATCTCTCTCCTGGG - Intronic
951564761 3:24002259-24002281 GTCTCTCCTCTCTCTCTCACTGG - Intergenic
951910206 3:27742155-27742177 ACCTCTGCCTTCTGCCTCCCGGG - Intergenic
952035801 3:29199259-29199281 GCATCCCCTTTCCATCTCCCAGG + Intergenic
953577678 3:44126380-44126402 TCCTCTCCTTTTTCTCTCACAGG + Intergenic
953736751 3:45500837-45500859 GCCACTCCTCTCTGCCTCACAGG - Intronic
954063349 3:48087806-48087828 GCCTCTCGATTCTCTCTCCCTGG - Intronic
954115607 3:48465467-48465489 ACCTCTCCTTTTTGTCTCAGAGG + Exonic
954149016 3:48648000-48648022 GCCTCCCCTTTCTTTCTCCTGGG - Intronic
954578022 3:51687397-51687419 CTCTCTCCTTGCTGTCTCCTGGG - Intronic
954939847 3:54361788-54361810 TCCTCTCCTGTCTCTCTCTCTGG - Intronic
955580278 3:60412418-60412440 TCATCTCCCTTCTGTCTGCCAGG + Intronic
956535017 3:70266444-70266466 GGGTCTCATTTCTGTCACCCAGG + Intergenic
956737474 3:72248800-72248822 GTCTCTCCTTTACTTCTCCCAGG + Intergenic
958810014 3:98850224-98850246 GCCTCATCTTTTGGTCTCCCTGG + Intronic
959026494 3:101245871-101245893 GACTCTTCATTCTGTCACCCCGG - Exonic
959289519 3:104456018-104456040 TCCTCCCCTCTCAGTCTCCCTGG - Intergenic
959388913 3:105748537-105748559 GCTTCTCCCTTCCTTCTCCCTGG - Intronic
960736275 3:120784594-120784616 GCTTCGCCTTTCTGCTTCCCTGG + Intergenic
961092083 3:124121960-124121982 TCTTCTCCTTTTGGTCTCCCAGG + Intronic
961467485 3:127090493-127090515 GCATCTCCCTTCTTCCTCCCTGG - Intergenic
961504958 3:127363778-127363800 TCATCTGCTTTCTGTCTCCATGG + Intergenic
961665331 3:128490577-128490599 GCGTCGCATTTCTCTCTCCCAGG - Intronic
961854339 3:129854314-129854336 GCCTCACCCTTCCGCCTCCCAGG - Intronic
961928060 3:130504231-130504253 GCTTCTACTTTCTGTCTCTTGGG + Intergenic
962422884 3:135243602-135243624 GCCCCTCCTGGCTCTCTCCCAGG - Intronic
962815199 3:138991267-138991289 GAATCTGCTTTCTGTCTCTCTGG + Intergenic
963017900 3:140843196-140843218 AGCTCTATTTTCTGTCTCCCTGG + Intergenic
963100290 3:141595741-141595763 GCCTCTGCCTTCTGTGTACCTGG + Intronic
963106926 3:141655269-141655291 TCCTCTCATTTCAGTCTTCCAGG - Intergenic
963185093 3:142406632-142406654 TCCTCTCACTTCAGTCTCCCAGG + Intronic
964569873 3:158099063-158099085 GTCACACCTATCTGTCTCCCCGG + Intronic
965710605 3:171553169-171553191 GCCTCTTCTTTCTATCTTCATGG - Intergenic
967749291 3:193095317-193095339 GCCTCTCCTGTTTCTGTCCCTGG - Intergenic
968570302 4:1336839-1336861 CCCTCTGCTCTCTGTCTTCCAGG + Exonic
968836323 4:2967091-2967113 GCATCTTCTTTCTGTGTCCATGG - Intronic
969359464 4:6653291-6653313 TCATCTCCTTTCTGTCTCTGTGG - Intergenic
969615368 4:8249197-8249219 GCCTGTCTTTTCTGTGTCCATGG - Intergenic
970583258 4:17492381-17492403 GCATGTCCTTGCTGTCCCCCTGG - Intronic
970631470 4:17951596-17951618 CCCTCTCCATTTTGTCTCCATGG + Intronic
971015950 4:22488860-22488882 TCTTCTCCTTTTTTTCTCCCAGG - Intronic
971082899 4:23235681-23235703 GCCTCTCATTTCAGGCCCCCAGG + Intergenic
971308865 4:25506699-25506721 GCCTTTCCTTGCTGCCCCCCAGG + Intergenic
971482827 4:27129323-27129345 GCCCCTCCTCTCTGTCTTCATGG - Intergenic
972292215 4:37699683-37699705 TCCTCTCTTCTCTTTCTCCCAGG + Intergenic
976151418 4:82096325-82096347 GCTTCTACTTTCTATCTCCATGG - Intergenic
977095675 4:92740859-92740881 GCCTCAGCTTTCTGACTACCTGG + Intronic
977331768 4:95645348-95645370 AGCTCTCCTTTCTCGCTCCCCGG - Intergenic
977745575 4:100542759-100542781 TCCTCACCTTTCTTTCTGCCTGG + Intronic
977943173 4:102879966-102879988 GAGTCTCTTCTCTGTCTCCCAGG + Intronic
978158803 4:105520941-105520963 GCCTCTCTTGTCTCTCTCCCTGG + Intergenic
978493277 4:109331962-109331984 GAATCTACTTTCTGTCTCTCTGG - Intergenic
978927610 4:114268090-114268112 GCCTCTCCTCTTCTTCTCCCTGG + Intergenic
979015501 4:115427362-115427384 GTCTTTCCCTTTTGTCTCCCCGG - Intergenic
980030190 4:127819250-127819272 GCCTCTCCCTTCTGTCTTATTGG - Intronic
980056053 4:128081102-128081124 GACTCTCGTCTCTGTCACCCAGG + Intronic
980095396 4:128484780-128484802 GCCTTTCCTCTCTGACTGCCAGG - Intergenic
981476700 4:145194430-145194452 CCCTCTACTTTCTGTCTCTATGG - Intergenic
981567879 4:146119791-146119813 GCCTCTCCTTACTGTATTCTAGG - Intergenic
981641241 4:146945869-146945891 GCCTCGCCTCTCTGTTTCCGTGG - Exonic
982575178 4:157100417-157100439 GCTTCTCTTTTCTGCCTCACTGG + Intronic
983475712 4:168209214-168209236 GCCTCTGTTTTCATTCTCCCAGG + Intergenic
984891117 4:184494057-184494079 GCCTCTCCATTCTGGCTCTCAGG - Intergenic
985712488 5:1437354-1437376 TCTTCTCCTCTCTGTCTCTCGGG - Intronic
985722493 5:1497075-1497097 GCCCACCCTTTCTGTCTCCTTGG - Intronic
985771410 5:1814084-1814106 GCCTTTCCCTTCTGTCCCCGTGG - Intronic
985983016 5:3488124-3488146 TCCTCCCCTCTCTGCCTCCCTGG - Intergenic
986000618 5:3628077-3628099 ACCGCTCCTTACTCTCTCCCGGG + Intergenic
986292807 5:6413394-6413416 TCCTCTCCTTTCTGTCTGTCGGG + Intergenic
986434487 5:7714932-7714954 ACATCTCCATTCTGTCTCCCTGG - Intronic
987908918 5:24116214-24116236 GCCTCTCTGTTCTGTTTCCTTGG + Intronic
988112702 5:26843466-26843488 GTGTCTCCTCTCTGTCACCCAGG - Intergenic
991218568 5:64185009-64185031 GACTGTCCTTTCTGTTTCACTGG + Intronic
992376094 5:76189015-76189037 GCCTTTCCTTTCTGTGTGCATGG - Intronic
992954818 5:81896668-81896690 GCATCTCCTTTCTGTCTCCATGG + Intergenic
993191252 5:84684913-84684935 GCTTTTCTTTTCTGTCTTCCTGG + Intergenic
995283334 5:110358897-110358919 ACTTCTCCTTCCTGTCGCCCTGG + Intronic
995354633 5:111224134-111224156 CTCTTTCCTTTCTCTCTCCCAGG - Exonic
995714655 5:115070301-115070323 GCATCTTCTTTCTCTTTCCCTGG + Intergenic
998003078 5:138639919-138639941 CCCTGCCCTTTCTGTCACCCTGG + Intronic
998454962 5:142264810-142264832 CTCTCTCTGTTCTGTCTCCCAGG + Intergenic
999112189 5:149131372-149131394 GCCTCTGCTATTTCTCTCCCTGG + Intergenic
999275568 5:150327663-150327685 GCCTCTTCCTTCCCTCTCCCTGG - Intronic
999282634 5:150375317-150375339 TCTTGTCCTTTGTGTCTCCCAGG + Exonic
999477737 5:151916740-151916762 GACTCTCATTGCTGTGTCCCAGG + Intronic
999923980 5:156355246-156355268 GCCTTTCCTTCCTGTGCCCCAGG + Intronic
1002038408 5:176491571-176491593 CCTTCTCCTTTCTGTTTTCCTGG - Intronic
1002076211 5:176710022-176710044 GTCTCTCCTTACTTACTCCCAGG + Intergenic
1002133000 5:177092746-177092768 GCCTCTCCTACCAGTCTGCCTGG + Exonic
1002701560 5:181128504-181128526 GCCTTTCCTTCCACTCTCCCGGG + Intergenic
1002705859 5:181160599-181160621 GCCTCTCCTCACTGCCTCCTAGG - Intergenic
1002833761 6:847984-848006 TCTTCTCCTTTTTGTCTTCCAGG - Intergenic
1002884201 6:1279389-1279411 GCCTCCAGTTTCTGTCTGCCGGG + Intergenic
1002969342 6:1997742-1997764 GTCTCTGTTTGCTGTCTCCCAGG - Intronic
1003224711 6:4192886-4192908 GTCTCACCCTGCTGTCTCCCTGG + Intergenic
1003931184 6:10926073-10926095 GCCTCTCCTGTCTCTGGCCCAGG - Intronic
1004127228 6:12885552-12885574 GCATTTTCTTTCTGTCTCTCTGG + Intronic
1005788404 6:29270943-29270965 GCCACCCCTTTCTTTCTTCCAGG - Intergenic
1005997503 6:30940326-30940348 GCCTGACCTGTCTGTGTCCCTGG + Intergenic
1006116642 6:31779296-31779318 GCCTCACCTTTCTCCCTCCCTGG - Intronic
1006218933 6:32471353-32471375 GCCCCCACATTCTGTCTCCCTGG + Intergenic
1007410512 6:41658671-41658693 GCTTCACCTTTCCGTCTCCAAGG - Intergenic
1008911298 6:56736488-56736510 TTCTCTCCTTTCTGCCTCCAGGG + Intronic
1009578601 6:65500748-65500770 CCCTCTTATTTCTCTCTCCCAGG + Intronic
1011026625 6:82876365-82876387 GGCTCTCCTCTCTGCCTCCATGG + Intergenic
1011742650 6:90377975-90377997 GACTCTCCCCTCTGTCTCCCAGG + Intergenic
1012840643 6:104325029-104325051 TCGTCTCCCTTCTTTCTCCCTGG - Intergenic
1013343770 6:109239913-109239935 CCTGCTCCTTTCTGTCTCCTGGG - Intergenic
1013946590 6:115729137-115729159 GCCTCTGCTGTGTGTCACCCAGG + Intergenic
1014261313 6:119221496-119221518 GAGTCTCATTTCTGTCACCCAGG + Intronic
1014430763 6:121367447-121367469 GGGTCTCATTTTTGTCTCCCAGG - Intergenic
1015602884 6:134927777-134927799 TCCACTCCTTCCTGTTTCCCAGG + Intronic
1015729774 6:136335666-136335688 GACTTCCCTTTCTCTCTCCCTGG + Intergenic
1016077607 6:139816048-139816070 ACCTCTCCTTGCTGTCTCCATGG - Intergenic
1016272067 6:142301531-142301553 GCTTCTCCTTTCTCTCGCCGAGG + Intergenic
1016575505 6:145565629-145565651 GACTTTCCTTTCTGGGTCCCTGG - Intronic
1016845660 6:148565832-148565854 GTGTCTCCTTTCTTTCTTCCTGG + Intergenic
1017237927 6:152136725-152136747 GGCTCTCCTTGCTGTCAGCCTGG + Exonic
1017969598 6:159299915-159299937 GCCTCCATTTGCTGTCTCCCAGG - Intergenic
1018016586 6:159718016-159718038 GTCTCTCCCCTCTGTCACCCAGG + Intronic
1018654366 6:166019602-166019624 GGCTTTCCTTTCTCTCTGCCTGG - Intergenic
1019254184 7:38841-38863 TCCTCTCTTTTCTGTTTCTCTGG - Intergenic
1019551575 7:1605703-1605725 GCCTCTATTTTGTGTCTCCATGG - Intergenic
1019710037 7:2513992-2514014 ACCTCTTCTTTCTGGCCCCCTGG + Intronic
1019752360 7:2739315-2739337 GAATCTGCTTTCTGTCTCCATGG + Intronic
1019789435 7:3001349-3001371 GCCTCCCCTTTCTTTCCCCATGG - Intronic
1020926775 7:14337952-14337974 GTCTTTGCTTTCTGTTTCCCAGG + Intronic
1022357084 7:29626179-29626201 GCCTCTCCCTTCTGCCTATCTGG + Intergenic
1023466513 7:40461775-40461797 TCCACTCCTTCCTTTCTCCCTGG - Intronic
1023482114 7:40645333-40645355 GTGGCTCTTTTCTGTCTCCCAGG + Intronic
1023923593 7:44648931-44648953 GCCTCTCTTTGCAGTGTCCCCGG + Intronic
1023927474 7:44680276-44680298 CCCTCTCAGTTCTGTCTCTCTGG + Intronic
1024590654 7:50879893-50879915 CTCTCTCTTGTCTGTCTCCCAGG - Intergenic
1026283838 7:68945748-68945770 GCCTCTGCCTTCAGTCTCACAGG + Intergenic
1026432946 7:70366401-70366423 GCCTCCACTTTCTCTCTCTCTGG - Intronic
1026771564 7:73204167-73204189 GAATCTCCTTTCTGTTGCCCAGG - Intergenic
1027012430 7:74757563-74757585 GAATCTCCTTTCTGTTGCCCAGG - Intronic
1027075610 7:75188490-75188512 GAATCTCCTTTCTGTTGCCCAGG + Intergenic
1027939918 7:84664702-84664724 TTCTCTCCTTTCTGGCTTCCTGG - Intergenic
1028978068 7:96936068-96936090 GCCTTTCCTCTCTGTGTGCCTGG - Intergenic
1029320244 7:99752434-99752456 GCTTCTCCTTGCTGTCAGCCTGG - Intergenic
1029451696 7:100645152-100645174 GACCCTGGTTTCTGTCTCCCTGG + Intronic
1030173360 7:106627073-106627095 GCCTCTTCGCTCTGTCGCCCAGG + Intergenic
1030614858 7:111728726-111728748 CCCTCTCGTTTCCTTCTCCCCGG - Intronic
1031203619 7:118724559-118724581 GACTCTCATTGCTGTCCCCCAGG - Intergenic
1031273247 7:119682139-119682161 GTCTCTCCTTTCTGCCTTTCTGG + Intergenic
1031984595 7:128155325-128155347 CCCTCTCCTCTCTGCCTTCCAGG - Intergenic
1032068947 7:128792036-128792058 CCCTCTCCTCCCTGTCCCCCCGG + Exonic
1032467160 7:132153355-132153377 CCCTCCCCGCTCTGTCTCCCTGG - Intronic
1032488257 7:132304813-132304835 GCAACCCCTTTGTGTCTCCCAGG + Intronic
1032575233 7:133046585-133046607 GAGTCTCCCTTCTGTCGCCCAGG + Intronic
1032588914 7:133174603-133174625 TCCTCCCACTTCTGTCTCCCAGG + Intergenic
1032872774 7:136003823-136003845 GCCACTTCTTTCTGCCACCCGGG + Intergenic
1033619221 7:143047543-143047565 GCCACTCAATTCTGTCTCCTGGG - Intergenic
1034853210 7:154515499-154515521 CCCCTTCCTTCCTGTCTCCCAGG + Intronic
1034943072 7:155244519-155244541 CCCTCTACTTCCTGTCTCCATGG - Intergenic
1034960317 7:155360651-155360673 TCCTCTCCTTCCTGACTCCCCGG + Intronic
1035520716 8:273679-273701 GCCTCCCACTTCTGGCTCCCGGG - Intergenic
1035563571 8:627024-627046 GACACTCCCTTCTGTCTCCTCGG + Intronic
1035871318 8:3138778-3138800 AGCTCTTATTTCTGTCTCCCAGG - Intronic
1036088399 8:5638064-5638086 GACTCTCCCTTCTATCTCCCAGG + Intergenic
1036147244 8:6265459-6265481 ACCTCTTCTTTGTGTCTCACTGG - Intergenic
1036555137 8:9852942-9852964 CCCACTCATTTCTGTCACCCAGG - Intergenic
1037154958 8:15688725-15688747 TCCTCTCCTCTCTGTATGCCAGG + Intronic
1037235076 8:16710255-16710277 TCCTCCCATTTCTGCCTCCCAGG - Intergenic
1037483464 8:19326342-19326364 GCCTCTCCTTTGGGACACCCCGG - Intronic
1037607519 8:20450088-20450110 TCATCTCCTTCCTTTCTCCCTGG - Intergenic
1037952859 8:23030029-23030051 TCCTCTCCTTGCAGTCTCTCAGG - Intronic
1038016394 8:23519394-23519416 CCCTCTCCTCTCAGGCTCCCAGG - Intergenic
1038817649 8:30921897-30921919 TAATCTACTTTCTGTCTCCCTGG - Intergenic
1039016845 8:33159080-33159102 GCCGCTCCTTCCTTTCTTCCTGG + Intergenic
1039451014 8:37675206-37675228 GCCTCTCCTGTCTCTGTCTCCGG + Intergenic
1043120687 8:76319584-76319606 TCCTATCCTTTCTGTTTCTCTGG - Intergenic
1043514076 8:80980012-80980034 ACTTCCTCTTTCTGTCTCCCAGG + Intronic
1044971376 8:97623645-97623667 GGCTCTCCTCTCTGGCTCTCAGG + Intergenic
1045543852 8:103110991-103111013 GTCTCTGCTTTCCCTCTCCCTGG - Intergenic
1046253142 8:111660420-111660442 CCTTCTCCTTTCTGTCTTTCTGG - Intergenic
1047236325 8:123045347-123045369 CCCTCTCGCTTCTGTCACCCAGG + Intronic
1047751435 8:127883723-127883745 CTCTCTCCTCTCTGCCTCCCAGG - Intergenic
1048439769 8:134451244-134451266 ACCTCTCCTTTGTGTTTCCCTGG - Intergenic
1048573969 8:135676639-135676661 GCCCCTCCTTCCTGTCTCACTGG + Intergenic
1049259316 8:141630273-141630295 GCCTCTCTCTTCTGGCTCCACGG + Intergenic
1049454008 8:142677889-142677911 GTCTCTCCTGCCTGCCTCCCTGG - Intronic
1049562148 8:143317222-143317244 GCCTCTCCTCCCTCTGTCCCTGG - Intronic
1049592507 8:143469004-143469026 GCCTGTCCCTGCTGCCTCCCTGG + Intronic
1049664708 8:143837755-143837777 GCCTCTCCTCCCTGTGCCCCAGG - Exonic
1049748078 8:144271387-144271409 GCCTCTCCCACCTGTCCCCCGGG + Intronic
1050531803 9:6597171-6597193 TATTCTACTTTCTGTCTCCCTGG - Intronic
1051240927 9:15055004-15055026 GCATCTCCTCGCTGCCTCCCGGG + Intergenic
1051660553 9:19422426-19422448 GCCTCTCTGTTATGTCTCCATGG - Intronic
1052235249 9:26205384-26205406 TGCTCTCCTTTCTCTTTCCCTGG - Intergenic
1052777071 9:32742903-32742925 GCCTCTGCTTTCTGTCCTTCCGG - Intergenic
1054973896 9:71120782-71120804 GGCTTTTCTTTCTCTCTCCCTGG - Intronic
1056376629 9:86020193-86020215 GTCTCTCCTATCTCTCTTCCAGG - Intronic
1056752837 9:89364359-89364381 GCCTCTCCATGCTGTGGCCCTGG - Intronic
1057271829 9:93655912-93655934 GCCACTCCTGTCTCTCTCCCAGG + Exonic
1057552880 9:96064993-96065015 GCCTCTGCTTCCTGTTTCTCTGG + Intergenic
1057835689 9:98443216-98443238 GCCTCCTCTTTGTTTCTCCCAGG + Intronic
1057873347 9:98734211-98734233 GCCTTTCCTTTCTTTTTCACTGG - Exonic
1057999334 9:99849094-99849116 GCCCCTTCTTTCTGTTTCACTGG + Intronic
1058460438 9:105177496-105177518 GACTCTTCTTTGTGTCTCCTGGG - Intergenic
1059391550 9:114002471-114002493 GCCTCTCCTCCCTGTCTGCCAGG - Intronic
1060205667 9:121681402-121681424 GTGTCTTCATTCTGTCTCCCAGG + Intronic
1060366653 9:123022835-123022857 GCTTTTCTTTTCTGTCTTCCTGG + Intronic
1060495532 9:124115744-124115766 CCCTCTACTTTCTGTCTCCATGG - Intergenic
1060987817 9:127829827-127829849 GTCTCTCCTCTGTGTCCCCCAGG - Exonic
1061045749 9:128163932-128163954 GCCTCTCTCCTCTGTATCCCAGG + Intergenic
1061076131 9:128342533-128342555 GCCTCTCCCATCTGTCTATCTGG + Intronic
1061390958 9:130316795-130316817 ATCTCTGCTTTCTGGCTCCCAGG - Intronic
1061433857 9:130548190-130548212 GCCTGTCCCTTCTCTCTCCCAGG - Intergenic
1061741964 9:132713706-132713728 TCCTCTACCTTCTGTCTCCATGG - Intergenic
1062351382 9:136141100-136141122 GCCTCTGCTGTCTGTCTCCAGGG + Intergenic
1062746218 9:138213700-138213722 TCCTCTCTTTTCTGTTTCTCTGG + Intergenic
1203526662 Un_GL000213v1:97127-97149 GACTCGCCTTTCTGTGGCCCTGG - Intergenic
1186459564 X:9737517-9737539 GAATCTCCTTTCTGTCTCTATGG - Intronic
1187079062 X:15966952-15966974 CTCTCTTCTTTCTGTCTCCAAGG + Intergenic
1187201391 X:17136828-17136850 GAATCTCCTTTCTGTCTCCATGG + Intronic
1188089143 X:25940636-25940658 CACTCTCCTTTCTTTCCCCCAGG + Intergenic
1188363061 X:29280721-29280743 CACTTTGCTTTCTGTCTCCCCGG - Intronic
1188499941 X:30814609-30814631 GCCTCACCCTTCTGAGTCCCTGG + Intergenic
1188772832 X:34175427-34175449 CCATCTCTGTTCTGTCTCCCAGG - Intergenic
1188991008 X:36820195-36820217 GCCTATCAATTCTGTCTCCCTGG + Intergenic
1190333577 X:49249905-49249927 GGCCCTCCTGTCTGCCTCCCAGG + Intronic
1190774814 X:53544259-53544281 GCATCTCCTTTCTGCTTCCTTGG - Intronic
1191633615 X:63351606-63351628 CCATCTGCTTTCTGTCTTCCAGG + Intergenic
1192176223 X:68887202-68887224 CCCTCTCCCTTTTGTCTCCTAGG + Intergenic
1192211628 X:69131489-69131511 GCCTGCCCTTTCTGGCCCCCAGG - Intergenic
1192243841 X:69357501-69357523 GCCTCATTTTTCTGTGTCCCAGG + Intergenic
1192978119 X:76307605-76307627 GCCACTCCTCTCTGACCCCCTGG - Intergenic
1195492105 X:105482998-105483020 TCCTCTCATTTCTTTCTTCCAGG + Intronic
1195943014 X:110180576-110180598 GCCTCTCCCTACTGCCTCCCTGG - Intronic
1196334563 X:114516491-114516513 GCCTGTCCTTGATTTCTCCCAGG - Intergenic
1196458188 X:115904290-115904312 TCCCCTCCTGTCTGACTCCCAGG - Intergenic
1196553029 X:117052975-117052997 CCCTCTCCCTTGTGTCTTCCAGG - Intergenic
1197251200 X:124217995-124218017 GCCTCAGCCTTCTGTCTTCCGGG + Intronic
1198481163 X:137042503-137042525 ACTTATCCTTTCTGTCTCCATGG + Intergenic
1199032305 X:143014401-143014423 GTCTCTAGTTTCTGACTCCCAGG + Intergenic
1199606883 X:149585256-149585278 GCCCCTCACTTCTGCCTCCCGGG - Intronic
1199632240 X:149784112-149784134 GCCCCTCACTTCTGCCTCCCGGG + Intronic
1200096648 X:153667752-153667774 ACCAGTCCTTTCTCTCTCCCAGG + Intergenic
1201191591 Y:11448192-11448214 GTCCTTCCTTTCTGTCTCCCTGG - Intergenic
1201283148 Y:12358185-12358207 GCCTTTCCTTTCTGGCTTCCTGG + Intergenic