ID: 1067354023

View in Genome Browser
Species Human (GRCh38)
Location 10:45507449-45507471
Sequence CTTCTCCCTGTATCATGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067354023_1067354027 3 Left 1067354023 10:45507449-45507471 CCCATTCATGATACAGGGAGAAG 0: 1
1: 0
2: 2
3: 18
4: 193
Right 1067354027 10:45507475-45507497 AACAGAGATTACAAGGTGAGAGG No data
1067354023_1067354030 29 Left 1067354023 10:45507449-45507471 CCCATTCATGATACAGGGAGAAG 0: 1
1: 0
2: 2
3: 18
4: 193
Right 1067354030 10:45507501-45507523 GACGACAGGTCAAGAGAGCAAGG No data
1067354023_1067354029 15 Left 1067354023 10:45507449-45507471 CCCATTCATGATACAGGGAGAAG 0: 1
1: 0
2: 2
3: 18
4: 193
Right 1067354029 10:45507487-45507509 AAGGTGAGAGGAAGGACGACAGG No data
1067354023_1067354026 -4 Left 1067354023 10:45507449-45507471 CCCATTCATGATACAGGGAGAAG 0: 1
1: 0
2: 2
3: 18
4: 193
Right 1067354026 10:45507468-45507490 GAAGGAGAACAGAGATTACAAGG No data
1067354023_1067354028 7 Left 1067354023 10:45507449-45507471 CCCATTCATGATACAGGGAGAAG 0: 1
1: 0
2: 2
3: 18
4: 193
Right 1067354028 10:45507479-45507501 GAGATTACAAGGTGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067354023 Original CRISPR CTTCTCCCTGTATCATGAAT GGG (reversed) Intronic
901260953 1:7870288-7870310 CTTCTCCCTGTGTCCTCACTCGG - Intergenic
901296031 1:8161540-8161562 CTTCTCCTTGTATGAAAAATGGG + Intergenic
901822061 1:11836630-11836652 CCTCTCCCTGGATTCTGAATCGG - Intronic
905512374 1:38531992-38532014 ATTATCTCTGTTTCATGAATGGG - Intergenic
906677638 1:47704799-47704821 TTTCTCCCTGTATCCTCAAGTGG + Intergenic
909399891 1:75215598-75215620 CATATCCCTGAATCATGCATTGG + Intronic
909435695 1:75639420-75639442 ATTTTCCCTGTATCAAGCATAGG - Intergenic
909686331 1:78353532-78353554 CTTCTCCTTCCACCATGAATGGG - Intronic
918989194 1:191675980-191676002 TTTCTCCCTGTCTCAAGAACTGG - Intergenic
919304889 1:195819584-195819606 CCTATGCCTGTGTCATGAATGGG - Intergenic
919331542 1:196178326-196178348 CTTCTCCCTGTATCTTCATATGG - Intergenic
921999290 1:221458521-221458543 CTTCCCCCTGTATAATGCTTTGG - Intergenic
922082668 1:222312183-222312205 CTTCTCACTGTATCATTAAATGG + Intergenic
922953041 1:229575163-229575185 CTTCTCCCTGTATCTTCACATGG - Intergenic
923523623 1:234755868-234755890 CTTCTCCCTGTTTTTTAAATGGG + Intergenic
924069203 1:240258425-240258447 CTTCTCCATGTATCCTCAATTGG + Intronic
1063791444 10:9453218-9453240 TTTCTACCTGTATCATGCACAGG + Intergenic
1063821903 10:9845852-9845874 CTTCTCCCTGTATCCTCACATGG + Intergenic
1063902554 10:10749317-10749339 CTACTCCCTCTATAATAAATAGG + Intergenic
1064852837 10:19729359-19729381 ATTTTCACTGTATCCTGAATAGG + Intronic
1065436596 10:25709319-25709341 CTTCTCCCTGTGTCATCACGTGG + Intergenic
1067203499 10:44194768-44194790 CTTCTCCCTGTATCTTCACGTGG + Intergenic
1067354023 10:45507449-45507471 CTTCTCCCTGTATCATGAATGGG - Intronic
1069093814 10:64234037-64234059 CTTCTCCCTGTATCTTCACCTGG - Intergenic
1069350633 10:67522061-67522083 GTTATCACTGTATTATGAATGGG - Intronic
1072310084 10:94146195-94146217 CTTTTCCCTGGATTAGGAATTGG + Intronic
1073190894 10:101650028-101650050 CTTCTCCTTGAGTCATGCATAGG + Intronic
1074269141 10:111935797-111935819 CTTCTCCCTGTGTCATCACATGG + Intergenic
1078056657 11:8014788-8014810 CTTCTCACTGTATCCTCACTTGG + Intergenic
1078877801 11:15415512-15415534 CTCATCCCTGTCTCAGGAATGGG + Intergenic
1084423894 11:69073896-69073918 CTTCTCCCTGTATCCTCACGTGG + Intronic
1084715175 11:70869112-70869134 CTTCTCCCTGTATCCTCATGGGG - Intronic
1085387063 11:76163540-76163562 CCTCTCCCTGCATGATGACTTGG + Intergenic
1086593210 11:88540632-88540654 CTCCTCCCCGTGTCATGAAGTGG - Intronic
1088100601 11:106150960-106150982 GTGCTCACTGTATCATGAAGTGG + Intergenic
1089340100 11:117751500-117751522 CTTCTCTCTGTAACATGCCTGGG + Intronic
1091182587 11:133620120-133620142 CTTGTCTCTGTATCCTGTATGGG - Intergenic
1091737973 12:2938949-2938971 ATTCTTTCTGTATCATAAATAGG + Intronic
1092006943 12:5077953-5077975 TTTCTCCCTGCATCATGCCTGGG - Intergenic
1093282351 12:17210061-17210083 CTTCTCCCTGTATCTTCATGTGG + Intergenic
1093766175 12:22965604-22965626 CTTCTCCTGGCAACATGAATAGG + Intergenic
1097638026 12:62145641-62145663 CTTCTCTCTTTCTCCTGAATAGG - Intronic
1098019400 12:66136667-66136689 CTTCTCCCTGTGTCTTTAAATGG - Intronic
1099576883 12:84393422-84393444 CTTCCCCCTATAGCTTGAATGGG + Intergenic
1099973700 12:89525369-89525391 CGTCTCCCTGTAGCAGGACTGGG - Intronic
1101314683 12:103618300-103618322 CTTCTCACTGTATCTTCACTTGG - Intronic
1102918818 12:116776469-116776491 CCTCTCCCTGTATTATGACCTGG + Intronic
1102934652 12:116886128-116886150 GTTTTCCCTGTATGATGAACTGG - Intergenic
1103624362 12:122206884-122206906 CATCTCCCTTTAGCATGAAATGG - Exonic
1103679859 12:122684875-122684897 CTTCTCCCTGTGTCCTCACTTGG + Intergenic
1104110994 12:125704123-125704145 GTTCTCCCTTTACAATGAATAGG - Intergenic
1104120155 12:125791224-125791246 CTTCCCCCTGGATAATGACTAGG - Intergenic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1108633868 13:52313472-52313494 CGTCTCACTGTATCACGTATAGG - Intergenic
1108634289 13:52317170-52317192 CGTCTCACTGTATCACGTATAGG - Intergenic
1111229464 13:85324291-85324313 TTTCTGCCTGTAACATGAATGGG - Intergenic
1113349421 13:109513772-109513794 CTTCTCCCTGCATCCTCACTGGG + Intergenic
1115938321 14:38580198-38580220 CTTCTCCCTGCAGCATGGCTTGG - Intergenic
1116953998 14:50904831-50904853 CTTCTCACTGTATCCTCAAATGG - Exonic
1121314217 14:92951625-92951647 CTTCTCCCAGCATGAGGAATTGG - Intronic
1124029310 15:25995080-25995102 CATCTCCCTGTATTATTCATAGG + Intergenic
1125741809 15:41970478-41970500 CTTCTCTCTGTTTCATTATTTGG - Intronic
1126117907 15:45225732-45225754 CTTCTCCCTGTGTCCTCAAAGGG + Intergenic
1128706695 15:69842102-69842124 CTTCTCACTGTATCTTCACTTGG - Intergenic
1131855004 15:96584378-96584400 CTTATCCCTTTCTCTTGAATTGG + Intergenic
1132800034 16:1747475-1747497 CTTCTCCCTGTGTCCTCAACAGG + Intronic
1133161653 16:3915901-3915923 CTTCTCCCTGTTTCCTGATGGGG + Intergenic
1133593101 16:7265310-7265332 CTTCTCCCTGTATCTTCCCTTGG + Intronic
1134269786 16:12723510-12723532 CTTCTCCCTGTATCCTCACATGG - Intronic
1134374786 16:13661845-13661867 TTTCCCCATGTGTCATGAATAGG - Intergenic
1135654762 16:24238230-24238252 CTTCTCACTGTATCATCAAGGGG + Intergenic
1137576562 16:49603968-49603990 CTTCTCCCTGTATCAGGGCTTGG - Intronic
1139158582 16:64475301-64475323 CTTCTCCCTGGATCAAGAAATGG - Intergenic
1139280300 16:65764825-65764847 CTTCTCCCTGTATCCTTACATGG - Intergenic
1142645627 17:1312389-1312411 CTTCTCCCTGGCTCAGGAGTGGG - Intergenic
1144441185 17:15283539-15283561 CTCCTCCTTGTGTCATGAACTGG + Intergenic
1146990210 17:37263432-37263454 TTTATCCCTGTATCCTGAAATGG + Intronic
1150164024 17:62924291-62924313 CTTCACCCTGTATCTTACATAGG + Intergenic
1151757047 17:76081001-76081023 CTTCTCCCTCCATCATGAAGTGG + Intronic
1151903175 17:77030970-77030992 CTTCTCCCTGTATCCTCACGTGG - Intergenic
1153649774 18:7229687-7229709 CTTCTCCCTGTGTCTTCACTTGG + Intergenic
1155514679 18:26612519-26612541 CTTCTCCCTGTGTCCTCAAGTGG - Intronic
1155588728 18:27400124-27400146 GTTCTACATGTATCAGGAATGGG - Intergenic
1155677557 18:28448048-28448070 CTTCTGCTTTTATAATGAATGGG + Intergenic
1155833014 18:30541837-30541859 TTTCTCCTTGTATCATAAAATGG + Intergenic
1156125173 18:33896403-33896425 TTTGTACCTGTATCATGATTTGG - Intronic
1158326704 18:56320755-56320777 CTTCTCCCTGTGTCTTCAACTGG + Intergenic
1161146013 19:2678612-2678634 CTTCTCCCTGTGTTGTGGATGGG - Intronic
1166259525 19:41627813-41627835 TTTCTCCTGGTATCATGCATGGG - Intronic
1166441004 19:42815385-42815407 CTTCTCCCTGTATCCTCACAGGG - Intronic
1166460478 19:42983991-42984013 CTTCTCCCTGTATCCTCACAGGG - Intronic
1166964309 19:46518876-46518898 CTTCTCCCTGTATCCTCACATGG + Intronic
926367093 2:12143479-12143501 CTTCTCGCTGGATCAAGAAGAGG + Intergenic
926966775 2:18423564-18423586 CTTCTCCCTGTGTCATCACACGG + Intergenic
930043199 2:47145238-47145260 TTCCTCCCTTTATCATGAATAGG - Intronic
930413371 2:51055973-51055995 CTTCTGTCTTTATCATGAAGAGG + Intergenic
932261959 2:70334423-70334445 CTTCTCCCTGTATCATCACATGG - Intergenic
933004840 2:76978853-76978875 CCTTTCCCTGAAGCATGAATTGG + Intronic
933517594 2:83325492-83325514 TTTCTCCCTTTATCTTTAATAGG + Intergenic
934732619 2:96669110-96669132 CTTCTTCCTGGATCCTGAAAGGG - Intergenic
936486661 2:112931609-112931631 TTTCTCACTGTATGATGGATGGG - Intergenic
938055777 2:128213602-128213624 CTTCTCCCTGTATCCTAACGTGG - Intergenic
938598482 2:132812864-132812886 CTTCTCACTGTATCCTCAAGTGG + Intronic
942620197 2:177837006-177837028 CTTCCCCTTGTATCTGGAATTGG - Intronic
942991809 2:182210979-182211001 CTTCTTGCTGTATCATCAAATGG + Intronic
943888606 2:193256079-193256101 CTTCTCCCTGTATCTTCAAGGGG - Intergenic
944175025 2:196819400-196819422 CTTCTCCCTGTATCCTTACGTGG - Intergenic
947006241 2:225514526-225514548 CTTCTCCTTGTATCCTCAAAGGG + Intronic
948704601 2:239781093-239781115 CTTCTCCCTGTGTCCTCAAATGG + Intronic
1168915323 20:1480621-1480643 CTTCTCCCTGTATCTTCACATGG - Intronic
1169284449 20:4296332-4296354 CTTCTCCCTGTATCTTCACATGG - Intergenic
1171113837 20:22507611-22507633 CTTCTCCCTGTATCATTCCCAGG - Intergenic
1172886395 20:38234004-38234026 CTTCTCCCTGTATCTTCATGGGG - Intronic
1173180567 20:40803610-40803632 CTTCTCCCTGTGTCCTGACATGG + Intergenic
1173317478 20:41958113-41958135 CTTCTGCCTTCATCATGAAAAGG + Intergenic
1173906865 20:46635789-46635811 CTGCATCCTGTTTCATGAATTGG - Intronic
1175149128 20:56919253-56919275 GCTCTCCCTGTATCAGGAAGAGG - Intergenic
1177167157 21:17615194-17615216 CTTCTCCCTATATCCTCACTTGG - Intergenic
1178115571 21:29412955-29412977 CTTCTCCCTGTGTCTTCACTTGG - Intronic
1178348588 21:31853024-31853046 CTTCTCACTGTATCGTCATTTGG - Intergenic
1178725233 21:35045546-35045568 CTTCTCCCTGTTTCATCACATGG - Intronic
1183081719 22:35461075-35461097 CTTCTCCCTGTGTCCTCACTTGG + Intergenic
1183533736 22:38381763-38381785 CTTCTCACTGTAGCAGGTATAGG - Intronic
1184499566 22:44863588-44863610 CTTCTCCCTGCATCAAGAGCTGG - Intergenic
949306409 3:2646777-2646799 CTTCTCCCTGTATCCTCACATGG + Intronic
950144482 3:10639440-10639462 CTTCTCACTGTATCCTCAAATGG + Intronic
951947027 3:28149893-28149915 ATTCTCACTGTAGAATGAATGGG - Intergenic
953832490 3:46312415-46312437 CTCCTCCCTGTAGCATCAGTGGG - Intergenic
955983394 3:64549274-64549296 CTTCTCCCTGTTTCATCTTTTGG + Intronic
956161178 3:66354693-66354715 ATTCTCCCAGTCTCATGAAATGG - Intronic
956357598 3:68411201-68411223 CTTCTCACTGTATCATGGGTGGG + Intronic
958412922 3:93839995-93840017 CTTCTCCCTTTTTCTTAAATTGG - Intergenic
958682140 3:97344497-97344519 CTTCTCCCTGTATCCTCACATGG - Intronic
959727810 3:109563878-109563900 CATCACACTGTATCATGGATTGG - Intergenic
963090034 3:141475507-141475529 CTTCTGTCTGTTTCATGAAGAGG - Intergenic
964177382 3:153840497-153840519 CTTCTCCTTGTATCCTCAAATGG - Intergenic
965184293 3:165443671-165443693 GTTCTCCATGTAGCATCAATAGG + Intergenic
965246369 3:166276140-166276162 TTTTTCCCTGTACCTTGAATGGG + Intergenic
967179830 3:186894299-186894321 CTTCTCCCTGTATCTTCACATGG + Intergenic
967311031 3:188106379-188106401 CTTCTCTAGGTATCTTGAATGGG + Intergenic
967682036 3:192375365-192375387 TTTTTCCCTTTATCTTGAATTGG + Intronic
970039568 4:11780693-11780715 CTTCTCCCTGTATCTTCACGTGG + Intergenic
970781881 4:19747296-19747318 CTTCTCCCTGTATCCTGAAATGG + Intergenic
971193829 4:24453111-24453133 CTTCTCCCTGTATCTTCACATGG - Intergenic
971324637 4:25633978-25634000 CTTCTCCCTGTATCCTCACATGG + Intergenic
972632694 4:40856130-40856152 CTTTGACTTGTATCATGAATGGG - Intronic
974663995 4:64934907-64934929 CTTCTCAATGTATCCTGACTTGG + Intergenic
976445910 4:85129580-85129602 CACCTCCCTGTATCCTGACTGGG - Intergenic
977089069 4:92647377-92647399 CTTCACACTGTATCATTTATTGG - Intronic
977909578 4:102517199-102517221 GCTCTCCCTGTGTCATGATTTGG + Intronic
983817939 4:172155345-172155367 CTTCTCACTGTATCCTCACTTGG - Intronic
986528019 5:8701899-8701921 CTTATCCCTGTATCATAAAGTGG - Intergenic
987628324 5:20432633-20432655 CTTCTCCCTGTATCGTCACATGG + Intronic
988035164 5:25818244-25818266 CTTCTCCCTGTATCTTGACATGG - Intergenic
990068194 5:51745064-51745086 TTTCTCCATTTAACATGAATAGG + Intergenic
990559262 5:56967167-56967189 CTTCTCCCTGTGTCCTCAAATGG - Intronic
990771730 5:59254161-59254183 CTTCTCCAAGTATCATGTGTTGG - Intronic
992615958 5:78546468-78546490 ATTATCCCTGTTTCATGCATGGG - Intronic
993049439 5:82909698-82909720 CTTCTCACTTTATCATTCATAGG + Intergenic
994495661 5:100509188-100509210 CTTCTCCCTGTGTCCTCACTTGG - Intergenic
994613488 5:102075486-102075508 ATTATCCCTGAATCATAAATTGG - Intergenic
995103308 5:108343051-108343073 CTTCTCCCTGTATCCTCACATGG - Intronic
996139765 5:119892462-119892484 CTTCTCTCTGTATCATCACGTGG - Intergenic
996281550 5:121735625-121735647 CTTCTCTGTGTGTCATGCATGGG - Intergenic
996838180 5:127817237-127817259 CTTCTACCTGTATTTTAAATAGG - Intergenic
997297185 5:132775807-132775829 CTTCGCCCCGTATTATAAATTGG - Intronic
998783760 5:145686653-145686675 CTGCTTCCCGTTTCATGAATGGG - Intronic
999883433 5:155892488-155892510 CTACTCCCTATAGCATCAATTGG - Intronic
1000072042 5:157749851-157749873 CTTATCCCTCTGTCATGGATTGG - Intronic
1000827525 5:166064304-166064326 CTTCTCATTGTATCCTGACTTGG + Intergenic
1001545214 5:172566845-172566867 CTTCTCCCTGTTTTATAGATGGG - Intergenic
1004456124 6:15792991-15793013 CTTCTCCCTGTATCCTTATGTGG + Intergenic
1005319203 6:24635529-24635551 CTTCTCCTTGTATTATCAACTGG - Intronic
1005805657 6:29472098-29472120 CTTCTCCCTGTGTCATGACATGG - Intergenic
1008262519 6:49384517-49384539 CTTCTCCCTGTGTCTTTACTTGG - Intergenic
1008459009 6:51745904-51745926 CCTATCCCTGAATCATGATTAGG - Intronic
1009612945 6:65970266-65970288 CTTCTCCCTGTGTCATCACGTGG - Intergenic
1010914117 6:81594813-81594835 CTTCTCCTTGTATCCTGACTTGG - Intronic
1012409276 6:98937595-98937617 TTTCACCCTGTATCCTGAAATGG - Intronic
1015726423 6:136304015-136304037 CTTCTCCTTGTATCCTCAAGTGG - Intergenic
1019768813 7:2870698-2870720 CCTCTCCCTGTATCCTGCTTGGG - Intergenic
1023540278 7:41257308-41257330 CTGCTCCCTGTTTTCTGAATAGG - Intergenic
1029182260 7:98711518-98711540 CTTCTCCCTGTGTCATCACAGGG - Intergenic
1031604375 7:123749790-123749812 TTTCTCCCTGTATCGTGAATTGG + Intergenic
1035218484 7:157389963-157389985 CTTTTCCCTGTACCCTGATTGGG + Intronic
1036455115 8:8899871-8899893 ATGCTGCCTGTATCATGAAAAGG + Intergenic
1037307295 8:17518945-17518967 CTTCTCCCTGTGTCCTCAGTTGG + Intronic
1037939373 8:22940198-22940220 CTTCTTCCTATATCATGGAAGGG + Intronic
1038349259 8:26761551-26761573 CTTCTCCCTGTGTCTTCACTTGG - Intronic
1039594090 8:38775533-38775555 CTTCTCCCTGTGTCCTCATTTGG + Intronic
1039966398 8:42287195-42287217 CTTCTCCCTGGTGCATGAGTGGG - Intronic
1041723144 8:60994173-60994195 CTTCTCCCTGTATCTTCACGTGG + Intergenic
1043783599 8:84368068-84368090 CTTCTGCGTGTATCACGAGTTGG - Intronic
1047126938 8:121973123-121973145 CTTCTCCTTTTATCCTAAATTGG + Intergenic
1047591184 8:126329279-126329301 CATCTCCATGTGTCAAGAATGGG + Intergenic
1048250825 8:132865416-132865438 CTCCTCCCTGTATCCTCACTTGG - Intergenic
1049111102 8:140643996-140644018 CTTCTCCCTGTATCCTCATATGG - Intergenic
1053446050 9:38154069-38154091 CATCTGCCTGCATCATGAAGGGG + Intergenic
1055204887 9:73716829-73716851 ATTCTTCCTGTATCATTTATAGG - Intergenic
1057952522 9:99380937-99380959 CTCCTCCCTGTCACATGAATAGG - Intergenic
1059931356 9:119264117-119264139 CTTCACCCTGTTTCATGCGTAGG + Intronic
1185942228 X:4334551-4334573 CTTCTCCCTGTATCCTCACAGGG - Intergenic
1186103155 X:6177947-6177969 CTTCTCCCTGTATCCTCATGTGG - Intronic
1186120878 X:6359687-6359709 CTTCTCCCTGTGTCCTCAAAGGG - Intergenic
1186144647 X:6612718-6612740 CTTCTCCCTGTGTCCTCAAATGG + Intergenic
1186890403 X:13954020-13954042 CTTCTCACTGTATCCTCAAGTGG + Intergenic
1193993127 X:88333376-88333398 CTTCTCACTGTTTCATCAAACGG - Intergenic
1194653272 X:96541526-96541548 CTTCTCACTGTATGATCAATAGG - Intergenic
1196595171 X:117537562-117537584 CTTCTCCCTGCAGCATGACTTGG + Intergenic
1196896239 X:120339713-120339735 CTTCTTGCTGTATCATCACTGGG + Intergenic
1197056828 X:122131870-122131892 CTTCTCCCTTTCTCCTGAAGAGG + Intergenic
1200984346 Y:9290128-9290150 CTTGTGCCTGCCTCATGAATGGG - Intergenic
1201256833 Y:12115999-12116021 CTTCTCCCTGTATCCTCAGGTGG - Intergenic
1202593712 Y:26514255-26514277 GTTCTCACTGTAGCATGTATAGG + Intergenic