ID: 1067366358

View in Genome Browser
Species Human (GRCh38)
Location 10:45633105-45633127
Sequence TACTTTTTGCTGTAAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 294}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067366358 Original CRISPR TACTTTTTGCTGTAAGAAAG TGG (reversed) Intronic
901654655 1:10762414-10762436 TATTTTTTTCTTTAAAAAAGAGG + Intronic
902642017 1:17772886-17772908 TCCTCTTTGCTCTAAGGAAGAGG - Intronic
905094507 1:35457649-35457671 TCCATTTTGCTGACAGAAAGAGG + Intronic
908172824 1:61524609-61524631 TACTGTTTGCTGTAGGAGTGGGG - Intergenic
909346900 1:74600722-74600744 TAGTTTTTGGTGGAAGAAAAAGG - Intronic
909734514 1:78940727-78940749 TACTGTTTGCTGTAGAAAAAGGG + Intronic
909967547 1:81934115-81934137 TACGTTTTGCTGTCTTAAAGTGG + Intronic
910090723 1:83460317-83460339 TACTTTTTGCTTTAATAAGGAGG + Intergenic
910820833 1:91344063-91344085 AAGTTTTTGCTTCAAGAAAGTGG - Intronic
910985026 1:92996946-92996968 TTCTTTTTGCTCTATTAAAGAGG + Intergenic
912911822 1:113768815-113768837 GACTTTTAGTTATAAGAAAGTGG - Intronic
913066926 1:115264481-115264503 CTCTGTTTGCTGTAAGAAATAGG + Intergenic
915766729 1:158370827-158370849 TAGTTTTTTCCCTAAGAAAGAGG + Intergenic
916915012 1:169396914-169396936 TACTTATTTCTGTGAGAAATGGG - Intronic
916929952 1:169566558-169566580 TACTTTTTTCTGCTAGATAGTGG + Intronic
917528227 1:175808634-175808656 AACCTTTTGCTGTAATAAACTGG - Intergenic
918022101 1:180704034-180704056 TATTTTTTGATGGAAGAAACTGG + Intronic
918305564 1:183243027-183243049 TACTATTTGCTCTAGGCAAGTGG + Intronic
918688692 1:187452021-187452043 TTCTTTTTTCAGTAACAAAGTGG - Intergenic
921259371 1:213372025-213372047 TCCATTTTGCAGTAAGGAAGAGG - Intergenic
922092139 1:222406174-222406196 CACTTTTTTCTGTTAAAAAGAGG - Intergenic
923220712 1:231890386-231890408 TTATTTTTGCTTTACGAAAGTGG - Intronic
923888248 1:238181582-238181604 TACTTCTTGCTGGAAGGAGGCGG - Intergenic
924533233 1:244911171-244911193 TGCTTTTTACTATAAGCAAGTGG + Intergenic
1063456485 10:6186227-6186249 TGCTTTTGGCTGTAAGTAACTGG + Intronic
1067366358 10:45633105-45633127 TACTTTTTGCTGTAAGAAAGTGG - Intronic
1068151142 10:53133791-53133813 AATTTATTGCTCTAAGAAAGAGG - Intergenic
1068206938 10:53866924-53866946 TACTTTTGTTTGTAAGAATGAGG + Intronic
1069181241 10:65361778-65361800 AACATTTTGGAGTAAGAAAGTGG - Intergenic
1069222713 10:65904051-65904073 TACTTTTTTCGGTAAGAAATAGG + Intergenic
1071276067 10:84056286-84056308 TAATTTTGGCTGTAAAATAGAGG + Intergenic
1071320860 10:84455580-84455602 TATTTTATGCAGAAAGAAAGTGG - Intronic
1072066775 10:91879080-91879102 TTATTTTTGCTTTAACAAAGTGG - Intergenic
1072072089 10:91928239-91928261 TACTTTCAGTTGTAAGAATGTGG + Intronic
1073738663 10:106381528-106381550 TTCTTGAAGCTGTAAGAAAGAGG + Intergenic
1075497511 10:122937848-122937870 TACTTTCTTTGGTAAGAAAGAGG + Exonic
1077646063 11:3925449-3925471 TTCTTATTGCAGTAATAAAGTGG - Intronic
1079292807 11:19203533-19203555 TACTTTTTTCTGTAGATAAGAGG + Intronic
1079777099 11:24545451-24545473 TACTATGTGGTGTAAAAAAGGGG + Intronic
1080247031 11:30190981-30191003 TAATTTTGGCTGTAATAAATGGG - Intergenic
1080831185 11:35894692-35894714 TGCATTTTGCTGTAATACAGGGG + Intergenic
1081455904 11:43222375-43222397 TACTTTTTCCTGGAAGAAGCAGG - Intergenic
1082256802 11:50041272-50041294 TGTTTTTTTCTGTAAGCAAGAGG + Intergenic
1083512180 11:63220109-63220131 TACCTTTTGTTGTAAGGTAGAGG + Intronic
1085008598 11:73118625-73118647 TTCTTTTTGGTGTAAGGAAGAGG + Intronic
1087241001 11:95779425-95779447 TAATTTTGGCAATAAGAAAGTGG - Intronic
1089804608 11:121072512-121072534 TACTTCTTGGAGTAAGAAATAGG - Intronic
1091637813 12:2211263-2211285 TACTGTGAGGTGTAAGAAAGTGG - Intronic
1092000966 12:5032077-5032099 TACTTTTCACTGTCAGAAGGTGG + Intergenic
1092162928 12:6325895-6325917 TACTTCTTACCATAAGAAAGTGG - Intronic
1093370400 12:18357817-18357839 TACTTTTTGCTTTCAAGAAGTGG + Intronic
1093739394 12:22665147-22665169 TACTTATTTCTGTAAGTAACTGG - Intronic
1094720163 12:33055053-33055075 TACTTTTTACTGTAGAACAGTGG + Intergenic
1095654451 12:44652435-44652457 TGGTTTTTGCTGTAAAAATGAGG - Intronic
1095675345 12:44910833-44910855 TCCTTTTTTCTTTAAAAAAGTGG + Intronic
1098204183 12:68089672-68089694 TACTTTTTGTTCTAAGATAATGG - Intergenic
1100350151 12:93773568-93773590 TATTTCCTGCTGGAAGAAAGAGG + Intronic
1104183121 12:126401656-126401678 TTCTTTCTCCTGAAAGAAAGTGG - Intergenic
1104711966 12:130993693-130993715 TACTTCTGGCTGTGAGAAACAGG + Intronic
1105406933 13:20141146-20141168 TCATTTTTCCTGAAAGAAAGTGG + Exonic
1105448550 13:20478070-20478092 TACTTTCTGCTGTTAGCAATGGG - Intronic
1106206322 13:27599012-27599034 TAATTTTTACTGTAATAAAATGG + Intronic
1107256109 13:38428414-38428436 TCCATTTTCCTGTAAGAAAAGGG - Intergenic
1107369153 13:39723196-39723218 TACTGTTTGGGGGAAGAAAGAGG + Intronic
1107838277 13:44429961-44429983 TTCTTTTTGATGAGAGAAAGGGG - Intergenic
1108165104 13:47684786-47684808 TTCTATATGGTGTAAGAAAGGGG - Intergenic
1108787100 13:53917932-53917954 GAAATTTTGCTGTAAGAAAATGG + Intergenic
1109318187 13:60777141-60777163 TTGTATATGCTGTAAGAAAGAGG + Intergenic
1110110278 13:71736617-71736639 TTTTTTTTCCCGTAAGAAAGAGG + Intronic
1111426924 13:88097108-88097130 TTCTTCCTGCTGAAAGAAAGGGG - Intergenic
1114072786 14:19127775-19127797 TCCTTTTTGCTGCAACAAAATGG + Intergenic
1114089476 14:19272197-19272219 TCCTTTTTGCTGCAACAAAATGG - Intergenic
1114230163 14:20774139-20774161 TAAATTTTGTTGTAGGAAAGAGG + Intergenic
1114488227 14:23077653-23077675 TACTGTATGCTGTAAGAACTAGG + Intronic
1115096223 14:29639164-29639186 AAGTTTTTGCTTTAAAAAAGTGG + Intronic
1115263237 14:31474457-31474479 TACTTTTTGTGGGAAGAAAGAGG + Intergenic
1115599932 14:34945991-34946013 TTTTTTTTTCTGTAAGAAAATGG + Intergenic
1118750767 14:68806646-68806668 TGCTGTTTGCTGGCAGAAAGAGG + Intergenic
1119110327 14:71967053-71967075 TACTTTTTGGTGGTAGTAAGGGG + Intronic
1125102995 15:35936913-35936935 TAAATTTTGCTTTAAGAATGAGG + Intergenic
1126978426 15:54212781-54212803 TAATTTTAGCTGTCTGAAAGAGG - Intronic
1128434220 15:67629563-67629585 TTATTTTTGTTTTAAGAAAGGGG + Intronic
1130013598 15:80171008-80171030 TACTATTTGCTGCATGAAGGAGG + Intronic
1130646865 15:85736218-85736240 TTCTTTTTGCTGTTACAAAGAGG + Intronic
1131746900 15:95458443-95458465 CACTTTTTCCTGGAAGAAAATGG - Intergenic
1133503912 16:6391567-6391589 TTCTATTTGCTGTAAGCAAATGG + Intronic
1135825028 16:25719427-25719449 TACTTTTGGCTGTAAGCAAGAGG + Intronic
1138645777 16:58423528-58423550 TACTTTTTGTTTTTAGAAAAAGG - Intergenic
1138972097 16:62157747-62157769 CACTCTTTTCTGTTAGAAAGTGG + Intergenic
1140112494 16:72015941-72015963 TGCTTTTGGCTCTAACAAAGTGG + Intronic
1147058567 17:37854501-37854523 TTAATTTTGCTGTAGGAAAGGGG - Intergenic
1147477471 17:40726140-40726162 TCCATTTTGCTGAAAGAAGGTGG + Intergenic
1147613786 17:41816745-41816767 TACTATTTGCTGACAGCAAGTGG - Intronic
1149316025 17:55439626-55439648 TCCTGTTTTCTGAAAGAAAGGGG - Intergenic
1151822509 17:76504343-76504365 TACTTTCTTCTGTAAGCAAGGGG + Intergenic
1153003359 18:475995-476017 TATTTTTTGAGGAAAGAAAGGGG + Intronic
1153721869 18:7912201-7912223 TTGTGTATGCTGTAAGAAAGTGG + Intronic
1155410174 18:25535237-25535259 GATTTTTTTCTGAAAGAAAGTGG + Intergenic
1155627834 18:27856840-27856862 TAATATTTATTGTAAGAAAGGGG + Intergenic
1155832877 18:30540240-30540262 TACTTTTTGCTATAATGTAGAGG + Intergenic
1155907600 18:31470950-31470972 TACTTTATCCTATGAGAAAGAGG + Intronic
1156052698 18:32956536-32956558 AAATTATTGCTGTAAGTAAGTGG + Intronic
1159190824 18:65039880-65039902 TATTTTTTGTTGTAAGCACGAGG - Intergenic
1159360738 18:67399108-67399130 GACATTTTGCTGTAAGAGAGAGG - Intergenic
1159388984 18:67764053-67764075 GACTTAGTTCTGTAAGAAAGGGG - Intergenic
1160593080 18:79954998-79955020 TATTCTTTGCTGTAAGGATGGGG - Intergenic
1163930907 19:20390853-20390875 TAAATTTTGCTCTCAGAAAGGGG + Intergenic
1163970937 19:20794034-20794056 TAAATTTTGCTGTCACAAAGGGG + Intronic
1164058029 19:21639148-21639170 TATTTTTTGCTGTGACATAGGGG + Intergenic
926477848 2:13349835-13349857 TTGTTTGTGGTGTAAGAAAGGGG + Intergenic
926666514 2:15529736-15529758 TAAATTTTGCTGTTAGAAATGGG - Intronic
927231467 2:20828045-20828067 GACTTTTTGCCATAAGTAAGAGG + Intergenic
928077850 2:28281372-28281394 TATATTTTGCTGTATGAAATAGG + Intronic
928284713 2:29979744-29979766 TTCTGGTTGCTGTTAGAAAGAGG + Intergenic
928787058 2:34900852-34900874 TATCTTGTGGTGTAAGAAAGTGG - Intergenic
930001180 2:46862519-46862541 TACTTTCTGGTGTCAAAAAGAGG - Intergenic
930516543 2:52414493-52414515 TATTTGTTGTTGTAAGAATGGGG + Intergenic
931656928 2:64517960-64517982 GACATTGTGCTGTCAGAAAGAGG - Intergenic
931885134 2:66609087-66609109 TTATTTTTGCTCTAAGAAAAAGG + Intergenic
932546543 2:72716800-72716822 TCCCTTTTGATGAAAGAAAGAGG - Intronic
932849724 2:75172708-75172730 TACTTTCTGCTGTTAATAAGAGG - Intronic
933512224 2:83255422-83255444 AGCTGTTTGCTGTCAGAAAGTGG - Intergenic
935365257 2:102282642-102282664 TGCTATTTGCTGTAAGATAGGGG - Intergenic
936170564 2:110168547-110168569 TTTGTTTTGCTTTAAGAAAGGGG - Exonic
936413077 2:112277423-112277445 TACTTTGTGCACTAAGAGAGGGG - Intronic
938874993 2:135522843-135522865 GACTTTTTTCTGTAAGGAATTGG + Intronic
938985171 2:136568255-136568277 TACTTATTGAAGTAAAAAAGTGG - Intergenic
939975744 2:148715396-148715418 TTGTTTTTGGTGTAAGGAAGGGG + Intronic
941306146 2:163870186-163870208 TTCCTTTTGCTTTAATAAAGTGG - Intergenic
941687673 2:168464071-168464093 ATCTTTTTTCTGTAAGAAATTGG + Intronic
942074948 2:172349110-172349132 GACTTTTTGCAGAAAGAGAGTGG + Intergenic
942696111 2:178648176-178648198 TACTTTTTTCTGTAGGCAATAGG - Intronic
942794646 2:179803763-179803785 TATTTTTTTTTTTAAGAAAGGGG - Intronic
942980753 2:182078332-182078354 TACTTTTTGCAGTAAAAAGCAGG + Intronic
943307374 2:186280340-186280362 TTGTATTTGGTGTAAGAAAGGGG + Intergenic
943684597 2:190805170-190805192 TTCTTTTTTTTGTAAGAAACAGG - Intergenic
943726262 2:191254812-191254834 TACTTTTAGAAGTAAGGAAGGGG + Intronic
947252913 2:228128328-228128350 TACTTCTTGTGGAAAGAAAGTGG - Intronic
1169524814 20:6412843-6412865 TATTTTTTGATGTAACAAATTGG - Intergenic
1169533324 20:6509061-6509083 TGCTTTTTCCTGGAAGCAAGAGG - Intergenic
1169926570 20:10790443-10790465 TATTTGTGGCTGTAAGAAAAAGG + Intergenic
1170733955 20:18997680-18997702 TACTTTTTAATCTAAGAAAGTGG + Intergenic
1170972939 20:21133584-21133606 TACTGTTTCCTGGAAGACAGAGG + Intronic
1173683625 20:44907132-44907154 AACATATTGCTGTAGGAAAGGGG - Exonic
1174707854 20:52675378-52675400 TGCCTTTTGCTGTAAGACATGGG - Intergenic
1174928683 20:54789143-54789165 TAGTATTTGGTGTAAGGAAGGGG + Intergenic
1175377632 20:58540199-58540221 TGATTTTTCTTGTAAGAAAGTGG - Intergenic
1175884858 20:62284032-62284054 TTCTTTTTGCTGTAATTAAATGG - Exonic
1177029101 21:15960259-15960281 TGGTTTTTGCTGTCAGAGAGTGG + Intergenic
1177300328 21:19236055-19236077 TATTTTTTTCTGTAAGAAAATGG - Intergenic
1178942549 21:36918512-36918534 AACTGTTTATTGTAAGAAAGTGG + Intronic
1179302056 21:40121375-40121397 TACTATTTGATGTAAAAAATAGG + Intronic
1180491229 22:15850150-15850172 TCCTTTTTGCTGCAACAAAATGG + Intergenic
1180949924 22:19716329-19716351 TTCTTTTTGCTCTTTGAAAGGGG + Intronic
1181382276 22:22515600-22515622 TATCTTTTTGTGTAAGAAAGTGG - Exonic
1182508912 22:30804709-30804731 TACTTTTGGGTGGAAAAAAGTGG - Intronic
1183921929 22:41176665-41176687 TAGTTTTTGTTCTACGAAAGGGG + Intronic
949773799 3:7608887-7608909 TTCTGTATGATGTAAGAAAGGGG + Intronic
951750927 3:26035646-26035668 GACTTTGTGCTGTAAGACAAAGG - Intergenic
951858572 3:27225412-27225434 TTCTTCTTCCTGTAACAAAGTGG - Intronic
953298564 3:41748770-41748792 TACCTTTTTGTCTAAGAAAGGGG - Intronic
954970415 3:54647035-54647057 TTCTTTTTGCTGTAAGACTGAGG - Intronic
955806188 3:62737460-62737482 TTTTTTTTGCTGTAAGAGACAGG - Intronic
956492139 3:69784382-69784404 TACTTTTTGGGGTAAGAGAAGGG + Intronic
956759521 3:72427378-72427400 TATTTTTTCCTCTAAGAAAGTGG - Intronic
960864601 3:122186305-122186327 GACTTTTTGGTGGAAGAGAGTGG + Intronic
962073977 3:132061225-132061247 TTCTATATGGTGTAAGAAAGGGG + Intronic
963301650 3:143603875-143603897 TACTTTTTGCTTTTACAGAGGGG + Intronic
963703062 3:148650711-148650733 GCCTTTTGGTTGTAAGAAAGAGG + Intergenic
965313456 3:167160685-167160707 CACTTTTTGCTGGGAGAAGGTGG - Intergenic
966389053 3:179432298-179432320 TCCTTTTTGCTGCTAAAAAGAGG + Intronic
967078100 3:186023434-186023456 TACCTTTTGTAGTAAGACAGGGG + Intergenic
967450363 3:189616294-189616316 TACTCAATGCTGTCAGAAAGTGG - Intergenic
967629562 3:191729489-191729511 TACTGTTTGGTGTAAGACACAGG + Intergenic
967847594 3:194056585-194056607 TACTTTTTGCTGATATAAAATGG + Intergenic
968062256 3:195734500-195734522 TACTTTGTTTTGTAAAAAAGGGG + Intronic
968717624 4:2173149-2173171 TACTTTTGGCAGCAAGAAAGGGG + Intronic
969979363 4:11138719-11138741 TACTTTTTGGTCTATGAGAGGGG + Intergenic
970627910 4:17910396-17910418 TACTTTTTCCTCTTAGAAACGGG + Intronic
970833471 4:20370801-20370823 TACATTTTCCTGTAAAACAGAGG + Intronic
973622618 4:52742606-52742628 TACTTTTTATTTTAAAAAAGGGG - Exonic
973852745 4:54977351-54977373 TACCTTTCCCTTTAAGAAAGAGG - Intergenic
974131576 4:57762707-57762729 TACTTTTTGATTAGAGAAAGGGG + Intergenic
974652168 4:64768219-64768241 TACTTTGTGCTGTTGGAAGGAGG + Intergenic
975634846 4:76437747-76437769 TTCTTTTTGCAGGAAGAAAGAGG + Intronic
976033860 4:80792837-80792859 TATTTTTAGCTGTAAGACAAAGG + Intronic
977296849 4:95219486-95219508 TATTATTGGCTGTAAGTAAGTGG + Intronic
977320194 4:95504258-95504280 TGCTGTTTGCAGTAAGTAAGAGG - Intronic
977423492 4:96834514-96834536 CACTTTTTCCTGTAAGGTAGAGG + Intergenic
977748823 4:100583711-100583733 TACTTTCTGCTGTTACTAAGAGG + Intronic
978021982 4:103825571-103825593 TTCTTTTTCCTGGAAGAAAAGGG + Intergenic
978037932 4:104019607-104019629 TATTTTTTGCTGATAGAAAAAGG + Intergenic
979041070 4:115795817-115795839 TACTTTTTGCTCTGAGAGAGAGG - Intergenic
979372798 4:119909117-119909139 TTCTATTTGGTGTAAGAGAGGGG + Intergenic
979711983 4:123790525-123790547 TACTTTGGGATGTAAAAAAGAGG - Intergenic
979978513 4:127225929-127225951 TACCCTTTCCTGGAAGAAAGAGG + Intergenic
980182569 4:129419584-129419606 TAATTTTGGCAGAAAGAAAGGGG - Intergenic
981235491 4:142410452-142410474 TGCTTTGTTCTGGAAGAAAGAGG - Intronic
981500852 4:145449898-145449920 TACTGTTTGGAGTCAGAAAGAGG + Intergenic
982719267 4:158842504-158842526 TAGTTTGGGCTCTAAGAAAGAGG - Intronic
982750816 4:159159069-159159091 TACTTATTGCTGTAAGATTCTGG - Intronic
982796858 4:159656611-159656633 TAATGTTTGCTCTAAGAAAGAGG + Intergenic
982870157 4:160569248-160569270 TAATTTTTGTTTTTAGAAAGTGG + Intergenic
983528928 4:168789844-168789866 TACTTTTTCCTTAAAGAGAGAGG - Intronic
984249377 4:177313295-177313317 AACTTTATACTGTAACAAAGAGG - Intronic
984659291 4:182356007-182356029 TTCTATTTGCTTTCAGAAAGAGG - Intronic
985175266 4:187193657-187193679 TAATTTTGGTTGTATGAAAGTGG + Intergenic
985178387 4:187227998-187228020 TAATTTTACCTGTGAGAAAGTGG + Intergenic
989711347 5:44401063-44401085 TACTGTTTGCTGTAAAATATTGG - Intergenic
989727180 5:44600260-44600282 TATTATATGGTGTAAGAAAGGGG + Intergenic
990066832 5:51727077-51727099 TCCTTTCAGCTGGAAGAAAGTGG + Intergenic
990400850 5:55436079-55436101 TCCTTATTGCTCTAAGAAATAGG - Intronic
992293475 5:75304431-75304453 AACTTTTTTTTTTAAGAAAGAGG + Intergenic
992754469 5:79891147-79891169 TTCTTTTTGCTTTAAAAACGTGG + Intergenic
993361199 5:86978621-86978643 TACTTTTTGAAGTAAGGACGTGG + Intergenic
993602461 5:89945102-89945124 TATTTTTTACTGTTAGTAAGTGG + Intergenic
993929431 5:93919756-93919778 TCCTTTTTACTATAAGCAAGTGG + Intronic
994596155 5:101838473-101838495 TACTTAGTGCTGGAAGAATGTGG - Intergenic
997010407 5:129870488-129870510 TTGTATTTGGTGTAAGAAAGGGG - Intergenic
997038605 5:130224343-130224365 TAATTTTTGCTGAAAGCAAGGGG - Intergenic
998312480 5:141149184-141149206 TTCTTTTTGCTGTGAGAAGACGG + Intronic
998428310 5:142048732-142048754 GAAGTTTTGCTGTATGAAAGGGG + Intergenic
1001244401 5:170095161-170095183 TCCCTTTGGCTGTAAGAAATAGG - Intergenic
1001767712 5:174265626-174265648 TTGTATATGCTGTAAGAAAGGGG - Intergenic
1002016795 5:176330692-176330714 GGCTTTTTACTGTAAGAAAGGGG - Intronic
1002669427 5:180854382-180854404 CACATTCTGCTGTAAGCAAGAGG - Intronic
1003044572 6:2721453-2721475 TACTTTCTACTGAAAGAAATTGG - Intronic
1003260026 6:4508685-4508707 TACTGTTTCCAGTAAGAAATAGG - Intergenic
1004005512 6:11634114-11634136 TCCTTTTTTCTAAAAGAAAGGGG - Intergenic
1004013619 6:11712226-11712248 TGCTTTGCTCTGTAAGAAAGAGG + Intronic
1004573163 6:16867708-16867730 TCATTTTTGATGAAAGAAAGAGG - Intergenic
1006720666 6:36147992-36148014 TACCTGGTGCTGTAAGCAAGAGG - Intergenic
1006850267 6:37093151-37093173 TGCTTTTTACTGAGAGAAAGAGG - Intergenic
1007938926 6:45758665-45758687 TAATTTTTGTTTTCAGAAAGGGG - Intergenic
1007952040 6:45881164-45881186 TTCTTTTTGTTGAAAAAAAGGGG - Intergenic
1009306564 6:62098276-62098298 TTCTTTATACTGAAAGAAAGAGG - Intronic
1011103927 6:83758126-83758148 TGAGATTTGCTGTAAGAAAGAGG + Intergenic
1011568650 6:88708785-88708807 TACGTTTTCCAGTAAGAAAAGGG + Intronic
1011854824 6:91676548-91676570 CACTATTTGCTGTCTGAAAGAGG - Intergenic
1012151197 6:95756894-95756916 TACATTCTGCTTTAAGAATGGGG - Intergenic
1012419258 6:99044802-99044824 TAGTTTTTGAAGGAAGAAAGAGG + Intergenic
1012817212 6:104039307-104039329 TACGTGTTTTTGTAAGAAAGGGG - Intergenic
1013217410 6:108040354-108040376 TACTTTTTGCTGGAATGCAGTGG + Intergenic
1013711836 6:112909928-112909950 TACTTGTGGCTTTCAGAAAGTGG - Intergenic
1014577053 6:123086599-123086621 TATTTTTGGGTGTAAGAAAAGGG + Intergenic
1014689191 6:124541364-124541386 TCCTTTTTGTTGTATGAATGGGG - Intronic
1015287398 6:131502275-131502297 TACTTTTGGCTGCAAGTAACAGG - Intergenic
1016149312 6:140719458-140719480 TCCATTTTGCTTTAGGAAAGAGG - Intergenic
1016722723 6:147321222-147321244 TACTTCTTACTTTAAGAAACTGG - Intronic
1018116534 6:160591168-160591190 TACATTTTGTTGTAACAAAGTGG + Intronic
1019841168 7:3446442-3446464 TAATTTTTGCTGTAAGATGCTGG - Intronic
1021166068 7:17343209-17343231 TAATTTTTGCTTTTAGAAAAGGG + Exonic
1022591979 7:31672150-31672172 GACTTTTTGCTCCAGGAAAGGGG - Intergenic
1023559319 7:41456917-41456939 TTTTTTTTGGTGTAAGAAAGGGG - Intergenic
1026227412 7:68454765-68454787 GACTTTTTCCTGTACTAAAGTGG - Intergenic
1026326362 7:69314171-69314193 TACCTTGTGCTGTGAGACAGGGG - Intergenic
1026460879 7:70614287-70614309 TACTTTTTTTTTTATGAAAGTGG + Intronic
1026575751 7:71570383-71570405 CACGTTATGCTGGAAGAAAGTGG - Intronic
1026813778 7:73492578-73492600 TACTAATTCCTATAAGAAAGAGG + Intronic
1027307567 7:76916782-76916804 TACTTTTTGCTTTAATAAGGAGG + Intergenic
1027630374 7:80596824-80596846 CATGTTTTGCTCTAAGAAAGAGG + Intronic
1030600395 7:111585096-111585118 TTTTTTTAGTTGTAAGAAAGAGG + Intergenic
1030846699 7:114423944-114423966 TACTTTTTGCTCTACAAAAGAGG - Intronic
1031739174 7:125407127-125407149 TACTTTTGGCTGTAAGATTTAGG + Intergenic
1032672358 7:134096997-134097019 TATTTTTTTCTGTAAAAAAATGG - Intergenic
1032819036 7:135507761-135507783 TACTTTTTGTTGTAATACACTGG - Intronic
1032905454 7:136359520-136359542 TACTTATTGCTATGAGAATGAGG + Intergenic
1032972421 7:137180395-137180417 TAGTTTTTGCTTCACGAAAGTGG - Intergenic
1032989550 7:137377524-137377546 TACTGTATCCTTTAAGAAAGAGG - Intergenic
1033448272 7:141440558-141440580 TACTTTATGCTGCAAGAGACAGG + Intronic
1034308269 7:150064248-150064270 TACTTTCTCCAGTTAGAAAGTGG - Intergenic
1034798584 7:154036423-154036445 TACTTTCTCCAGTTAGAAAGTGG + Intronic
1037275990 8:17179412-17179434 TTCTTTTTGTTTTAAGAAACAGG + Intronic
1037441137 8:18917366-18917388 CACTTTTAGCTGTAAGAGAAAGG - Intronic
1038329734 8:26598637-26598659 TACTTTGTGCTGTAAGCTAACGG - Intronic
1038332610 8:26621115-26621137 AACTTTTTGGGGGAAGAAAGTGG + Intronic
1038355296 8:26823653-26823675 TCCTTTTTCCTATAAGACAGAGG + Intronic
1038927782 8:32159227-32159249 TAGTTTTTGTTTTAAGAAAAAGG + Intronic
1041495982 8:58485815-58485837 TACTATTTGCTGAAACAAACTGG - Intergenic
1042559159 8:70059590-70059612 TACATTTTTCTGTAATAAAAAGG - Intronic
1042890408 8:73603757-73603779 TATGTTTTGCTTTCAGAAAGAGG - Exonic
1043030514 8:75128764-75128786 TACTTTATGCTGAAAAAATGTGG - Intergenic
1044400748 8:91768752-91768774 TACTTTTTCTTGTAAGAAAGTGG - Intergenic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1046773172 8:118136761-118136783 TAATGTCTGCTGTAAGAAAATGG + Intergenic
1047689344 8:127335480-127335502 TCCTTGTTGCTGTAGGACAGAGG + Intergenic
1048141207 8:131796443-131796465 TACTTTCTGAGGTAAGAAAATGG - Intergenic
1048868472 8:138778111-138778133 TGCTTCTTGATGTGAGAAAGGGG + Intronic
1051856715 9:21575719-21575741 TCTTTTTTGCTGTAAGAATTGGG - Intergenic
1052482281 9:29046562-29046584 TTGTGTTTGGTGTAAGAAAGGGG - Intergenic
1054769419 9:69069918-69069940 TCCAATTTGCTGTAAGAAAATGG + Intronic
1055282593 9:74691606-74691628 TAATTTTTGCTGTAAATAACTGG + Exonic
1055498485 9:76879850-76879872 TACTCAGTTCTGTAAGAAAGAGG + Intronic
1056593536 9:87985254-87985276 TCCTTTTTTTTTTAAGAAAGGGG + Intergenic
1057542853 9:95991286-95991308 TTCTTTTTCCTGCAAGAATGTGG - Intronic
1058297346 9:103326021-103326043 TAGTACTTGCTGTAAGAAATGGG - Intergenic
1058340646 9:103892027-103892049 TGATTTTTGGTGTAAGGAAGGGG - Intergenic
1058778862 9:108312925-108312947 TAATTGGTGCTGTAAAAAAGTGG + Intergenic
1059572900 9:115459601-115459623 TAATGTTTGCTGTGAGAGAGGGG + Intergenic
1061273054 9:129554706-129554728 TGCTTTTGGCTGTAAGTAACAGG + Intergenic
1186477906 X:9872868-9872890 TACTTTTGGCTATTATAAAGTGG - Intronic
1187244952 X:17545693-17545715 TCCTGTTTGCTGTAGGAATGAGG + Intronic
1188137863 X:26512119-26512141 TACTTTGAGCTGAAAGAAATTGG + Intergenic
1188576566 X:31657942-31657964 TACTGTTGGCTGTAATAATGGGG - Intronic
1190873115 X:54441106-54441128 TGCTTTTTGCTTTATTAAAGTGG - Intronic
1193348118 X:80428158-80428180 TAGTTTTCTCTGGAAGAAAGTGG + Intronic
1193476249 X:81970123-81970145 TACTTTTTGCTGAATGGAGGAGG + Intergenic
1193834897 X:86330117-86330139 TAATTCTTGTTTTAAGAAAGAGG + Intronic
1193940592 X:87677130-87677152 TTGTTTATGGTGTAAGAAAGGGG - Intergenic
1194127622 X:90039754-90039776 TATGTTTTGCTTTCAGAAAGAGG - Intergenic
1194258252 X:91661575-91661597 TCCTCTTTGCTGTTGGAAAGAGG - Intergenic
1195262544 X:103147397-103147419 TACTTTTTAATCTAATAAAGGGG + Intergenic
1195264318 X:103165118-103165140 TACTTTTTAATGTAAGAAGGGGG - Intergenic
1196260218 X:113570391-113570413 TAGTATATGGTGTAAGAAAGGGG + Intergenic
1196669482 X:118350128-118350150 TACACGTTGCTGAAAGAAAGTGG - Intronic
1196755508 X:119154239-119154261 TATCTTTTGCTGGAAGCAAGTGG - Intergenic
1199033907 X:143030210-143030232 TCCTTTTTGGTGTAGGGAAGGGG + Intronic
1199183255 X:144883523-144883545 TTGTGTATGCTGTAAGAAAGGGG - Intergenic
1199492753 X:148419062-148419084 GACTTTTTGGTGTAAGGAAGGGG - Intergenic
1200577019 Y:4901081-4901103 TCCTCTTTGCTGTTGGAAAGAGG - Intergenic
1201395711 Y:13545573-13545595 TTGTTTGTGGTGTAAGAAAGGGG - Intergenic