ID: 1067369746

View in Genome Browser
Species Human (GRCh38)
Location 10:45672492-45672514
Sequence CTCGCCTTGCGGCCTGACGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067369746_1067369754 -10 Left 1067369746 10:45672492-45672514 CCGGCGTCAGGCCGCAAGGCGAG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1067369754 10:45672505-45672527 GCAAGGCGAGGGGCGGGGACAGG 0: 1
1: 0
2: 3
3: 67
4: 1176
1067369746_1067369755 1 Left 1067369746 10:45672492-45672514 CCGGCGTCAGGCCGCAAGGCGAG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1067369755 10:45672516-45672538 GGCGGGGACAGGACTCTACCCGG 0: 1
1: 0
2: 0
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067369746 Original CRISPR CTCGCCTTGCGGCCTGACGC CGG (reversed) Intronic
900202969 1:1419575-1419597 CTCGCCTACCGGGCTGAGGCCGG - Intronic
917325137 1:173824402-173824424 CTCGCTCTGCGGCCCCACGCAGG + Intronic
919365603 1:196657005-196657027 CTCGCTTTGTTGCCTGAGGCTGG + Intronic
920812729 1:209302571-209302593 CTGGCCTTGCAGCCTGAAGCTGG - Intergenic
923016000 1:230127108-230127130 CTCCCATTGCTGCCTGAGGCAGG + Intronic
1067369746 10:45672492-45672514 CTCGCCTTGCGGCCTGACGCCGG - Intronic
1067406697 10:46030283-46030305 CTCGCCTTCCCGCCACACGCCGG - Intronic
1067406710 10:46030321-46030343 CTCCCCTTCCGGCCACACGCCGG - Intronic
1067769769 10:49115133-49115155 CTCCCCTCGGGGCCTGCCGCTGG + Intronic
1070895722 10:79981972-79981994 CGAGGCTGGCGGCCTGACGCGGG - Intronic
1072088344 10:92102256-92102278 TTTGCCTTGAGGCCTGACGGAGG - Intronic
1076718013 10:132376679-132376701 CTCGCCCCGCGGCCTGCCGCAGG + Exonic
1077465688 11:2732783-2732805 CTCGCCTTGCAGCCGGAGCCTGG + Intronic
1085394670 11:76201245-76201267 CCCGCCTTGGAGGCTGACGCTGG + Intronic
1085760289 11:79235448-79235470 CTAGTCATGCGGCCTGACACAGG + Intronic
1095465275 12:42483211-42483233 CTCGCCCTGCGGCTGGACGGTGG + Intronic
1105018629 12:132801782-132801804 CTCACCCTGCAGCCTGACGCGGG + Exonic
1107964733 13:45588485-45588507 CTGGCCTTGGGGCCTGGAGCAGG - Intronic
1113805842 13:113109741-113109763 CTCCCCTCGCGGGCTGAGGCAGG + Intronic
1114664249 14:24368864-24368886 CTCTCATTGCGGCCAGACGGGGG - Intronic
1119598653 14:75959282-75959304 CTCGCCTTGCTGCGTGCCCCAGG - Exonic
1131121908 15:89828093-89828115 CTGGCCTTGCAGCCTGAGCCTGG - Intergenic
1134117706 16:11561664-11561686 CTGGCCTTGGGGCCTGAGGGAGG - Intronic
1142009952 16:87708909-87708931 CCAGCCTTGCTGCCTGACCCAGG - Intronic
1151994789 17:77601744-77601766 CTCGCCCTGCGTCCTGGCCCTGG - Intergenic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1161767233 19:6214454-6214476 CTCCCCTGGCCGCCTGACCCTGG + Intronic
1162512716 19:11129364-11129386 ATCGCCTTGCGGCCTGGGCCTGG - Intronic
1163783564 19:19262832-19262854 CTCCCCTTGCAGGCAGACGCCGG - Intergenic
937252652 2:120534256-120534278 CTGGCCTTGCGCCCTGGCTCAGG + Intergenic
938063720 2:128270118-128270140 CTGGCCTTGCTGCCTGCCCCTGG - Intronic
942045122 2:172095521-172095543 TCCGCCCTGCGGCCTGATGCTGG - Intergenic
1174383532 20:50172535-50172557 CCCGCTTTGCGGAGTGACGCAGG + Intergenic
1184722983 22:46326269-46326291 CCCGCCTTGGGGCCTGTCCCAGG + Intronic
954946122 3:54425758-54425780 CTAGCCTTAGGGCCTGACCCAGG - Intronic
962316638 3:134363586-134363608 CTGGCCTTGAGGCCTGAGGCTGG - Intronic
964786491 3:160400926-160400948 CTCTCCGTGCGGCCGGACGGCGG - Exonic
969522522 4:7686841-7686863 TTCGCCTTGCGGCCTGCTGACGG - Intronic
969619146 4:8270169-8270191 CTCGCCTTGCGGCGAGAGCCTGG + Exonic
972360255 4:38319992-38320014 CTCCCCCTACTGCCTGACGCTGG - Intergenic
985016347 4:185639120-185639142 CTCCCCTCCCGGCCTAACGCAGG - Intronic
1000337963 5:160255479-160255501 CTTGCCTTGAGGCCTGCCTCAGG - Intronic
1002780580 6:362410-362432 CTAGCACTGCGGCCTGACTCTGG + Intergenic
1006901102 6:37502109-37502131 CTCGCCTGGCTGCCTGACTGAGG + Intergenic
1015966153 6:138696814-138696836 CTGGCCATGCTTCCTGACGCTGG + Intergenic
1022363465 7:29685379-29685401 CAAGGCTGGCGGCCTGACGCGGG + Intergenic
1022697911 7:32728359-32728381 CAAGGCTGGCGGCCTGACGCGGG - Intergenic
1035458537 7:159024873-159024895 ATCGCGGTGCGCCCTGACGCTGG - Intergenic
1039883999 8:41645381-41645403 ATCGCCTTGCGGCCTGGCACTGG - Exonic
1062394022 9:136345487-136345509 CCCGCCCTGGGGCCAGACGCAGG + Intronic
1062480067 9:136746958-136746980 CTGGCCTTGTGGCCTCAGGCAGG - Intronic
1062507643 9:136886348-136886370 CGCGCCTGACGGACTGACGCCGG - Intronic
1185463939 X:344460-344482 CACGCACTGCGGCCTGAAGCGGG - Intronic
1188524118 X:31071345-31071367 CCCGCCTAGTGGCCTGACCCAGG + Exonic
1189030201 X:37442109-37442131 CCCGCCTGGTGGCCTGACCCAGG - Intronic