ID: 1067369874

View in Genome Browser
Species Human (GRCh38)
Location 10:45672991-45673013
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067369874_1067369881 5 Left 1067369874 10:45672991-45673013 CCTGACTCGTGCCCACGCGGGCG No data
Right 1067369881 10:45673019-45673041 AGGGCAGCCGCATGGCCTGCTGG No data
1067369874_1067369886 15 Left 1067369874 10:45672991-45673013 CCTGACTCGTGCCCACGCGGGCG No data
Right 1067369886 10:45673029-45673051 CATGGCCTGCTGGGAACGGCGGG No data
1067369874_1067369880 -3 Left 1067369874 10:45672991-45673013 CCTGACTCGTGCCCACGCGGGCG No data
Right 1067369880 10:45673011-45673033 GCGTCTGGAGGGCAGCCGCATGG No data
1067369874_1067369887 16 Left 1067369874 10:45672991-45673013 CCTGACTCGTGCCCACGCGGGCG No data
Right 1067369887 10:45673030-45673052 ATGGCCTGCTGGGAACGGCGGGG No data
1067369874_1067369882 6 Left 1067369874 10:45672991-45673013 CCTGACTCGTGCCCACGCGGGCG No data
Right 1067369882 10:45673020-45673042 GGGCAGCCGCATGGCCTGCTGGG No data
1067369874_1067369889 26 Left 1067369874 10:45672991-45673013 CCTGACTCGTGCCCACGCGGGCG No data
Right 1067369889 10:45673040-45673062 GGGAACGGCGGGGTTGAAGCCGG No data
1067369874_1067369885 14 Left 1067369874 10:45672991-45673013 CCTGACTCGTGCCCACGCGGGCG No data
Right 1067369885 10:45673028-45673050 GCATGGCCTGCTGGGAACGGCGG No data
1067369874_1067369883 11 Left 1067369874 10:45672991-45673013 CCTGACTCGTGCCCACGCGGGCG No data
Right 1067369883 10:45673025-45673047 GCCGCATGGCCTGCTGGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067369874 Original CRISPR CGCCCGCGTGGGCACGAGTC AGG (reversed) Intergenic