ID: 1067369878

View in Genome Browser
Species Human (GRCh38)
Location 10:45673002-45673024
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067369878_1067369885 3 Left 1067369878 10:45673002-45673024 CCCACGCGGGCGTCTGGAGGGCA No data
Right 1067369885 10:45673028-45673050 GCATGGCCTGCTGGGAACGGCGG No data
1067369878_1067369886 4 Left 1067369878 10:45673002-45673024 CCCACGCGGGCGTCTGGAGGGCA No data
Right 1067369886 10:45673029-45673051 CATGGCCTGCTGGGAACGGCGGG No data
1067369878_1067369881 -6 Left 1067369878 10:45673002-45673024 CCCACGCGGGCGTCTGGAGGGCA No data
Right 1067369881 10:45673019-45673041 AGGGCAGCCGCATGGCCTGCTGG No data
1067369878_1067369883 0 Left 1067369878 10:45673002-45673024 CCCACGCGGGCGTCTGGAGGGCA No data
Right 1067369883 10:45673025-45673047 GCCGCATGGCCTGCTGGGAACGG No data
1067369878_1067369887 5 Left 1067369878 10:45673002-45673024 CCCACGCGGGCGTCTGGAGGGCA No data
Right 1067369887 10:45673030-45673052 ATGGCCTGCTGGGAACGGCGGGG No data
1067369878_1067369882 -5 Left 1067369878 10:45673002-45673024 CCCACGCGGGCGTCTGGAGGGCA No data
Right 1067369882 10:45673020-45673042 GGGCAGCCGCATGGCCTGCTGGG No data
1067369878_1067369889 15 Left 1067369878 10:45673002-45673024 CCCACGCGGGCGTCTGGAGGGCA No data
Right 1067369889 10:45673040-45673062 GGGAACGGCGGGGTTGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067369878 Original CRISPR TGCCCTCCAGACGCCCGCGT GGG (reversed) Intergenic