ID: 1067369881

View in Genome Browser
Species Human (GRCh38)
Location 10:45673019-45673041
Sequence AGGGCAGCCGCATGGCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067369874_1067369881 5 Left 1067369874 10:45672991-45673013 CCTGACTCGTGCCCACGCGGGCG No data
Right 1067369881 10:45673019-45673041 AGGGCAGCCGCATGGCCTGCTGG No data
1067369873_1067369881 6 Left 1067369873 10:45672990-45673012 CCCTGACTCGTGCCCACGCGGGC No data
Right 1067369881 10:45673019-45673041 AGGGCAGCCGCATGGCCTGCTGG No data
1067369879_1067369881 -7 Left 1067369879 10:45673003-45673025 CCACGCGGGCGTCTGGAGGGCAG No data
Right 1067369881 10:45673019-45673041 AGGGCAGCCGCATGGCCTGCTGG No data
1067369871_1067369881 7 Left 1067369871 10:45672989-45673011 CCCCTGACTCGTGCCCACGCGGG No data
Right 1067369881 10:45673019-45673041 AGGGCAGCCGCATGGCCTGCTGG No data
1067369878_1067369881 -6 Left 1067369878 10:45673002-45673024 CCCACGCGGGCGTCTGGAGGGCA No data
Right 1067369881 10:45673019-45673041 AGGGCAGCCGCATGGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067369881 Original CRISPR AGGGCAGCCGCATGGCCTGC TGG Intergenic