ID: 1067369886

View in Genome Browser
Species Human (GRCh38)
Location 10:45673029-45673051
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067369878_1067369886 4 Left 1067369878 10:45673002-45673024 CCCACGCGGGCGTCTGGAGGGCA No data
Right 1067369886 10:45673029-45673051 CATGGCCTGCTGGGAACGGCGGG No data
1067369874_1067369886 15 Left 1067369874 10:45672991-45673013 CCTGACTCGTGCCCACGCGGGCG No data
Right 1067369886 10:45673029-45673051 CATGGCCTGCTGGGAACGGCGGG No data
1067369873_1067369886 16 Left 1067369873 10:45672990-45673012 CCCTGACTCGTGCCCACGCGGGC No data
Right 1067369886 10:45673029-45673051 CATGGCCTGCTGGGAACGGCGGG No data
1067369871_1067369886 17 Left 1067369871 10:45672989-45673011 CCCCTGACTCGTGCCCACGCGGG No data
Right 1067369886 10:45673029-45673051 CATGGCCTGCTGGGAACGGCGGG No data
1067369879_1067369886 3 Left 1067369879 10:45673003-45673025 CCACGCGGGCGTCTGGAGGGCAG No data
Right 1067369886 10:45673029-45673051 CATGGCCTGCTGGGAACGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067369886 Original CRISPR CATGGCCTGCTGGGAACGGC GGG Intergenic