ID: 1067372652

View in Genome Browser
Species Human (GRCh38)
Location 10:45699631-45699653
Sequence TAAGTGGGCCAGTTTGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067372645_1067372652 8 Left 1067372645 10:45699600-45699622 CCCACTGTGTGGACTGTGAGACC No data
Right 1067372652 10:45699631-45699653 TAAGTGGGCCAGTTTGAACTTGG No data
1067372646_1067372652 7 Left 1067372646 10:45699601-45699623 CCACTGTGTGGACTGTGAGACCC No data
Right 1067372652 10:45699631-45699653 TAAGTGGGCCAGTTTGAACTTGG No data
1067372643_1067372652 28 Left 1067372643 10:45699580-45699602 CCAAAACATGCGTGGGAACGCCC No data
Right 1067372652 10:45699631-45699653 TAAGTGGGCCAGTTTGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067372652 Original CRISPR TAAGTGGGCCAGTTTGAACT TGG Intergenic
No off target data available for this crispr