ID: 1067376010

View in Genome Browser
Species Human (GRCh38)
Location 10:45727853-45727875
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 2, 1: 1, 2: 1, 3: 14, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067376010_1067376011 -8 Left 1067376010 10:45727853-45727875 CCTGGACTAAATGGGGTGGGAAA 0: 2
1: 1
2: 1
3: 14
4: 133
Right 1067376011 10:45727868-45727890 GTGGGAAACAAGCCAGTATGTGG No data
1067376010_1067376017 22 Left 1067376010 10:45727853-45727875 CCTGGACTAAATGGGGTGGGAAA 0: 2
1: 1
2: 1
3: 14
4: 133
Right 1067376017 10:45727898-45727920 TTAATGGGATTCTTCAAATCGGG No data
1067376010_1067376019 24 Left 1067376010 10:45727853-45727875 CCTGGACTAAATGGGGTGGGAAA 0: 2
1: 1
2: 1
3: 14
4: 133
Right 1067376019 10:45727900-45727922 AATGGGATTCTTCAAATCGGGGG No data
1067376010_1067376016 21 Left 1067376010 10:45727853-45727875 CCTGGACTAAATGGGGTGGGAAA 0: 2
1: 1
2: 1
3: 14
4: 133
Right 1067376016 10:45727897-45727919 TTTAATGGGATTCTTCAAATCGG No data
1067376010_1067376014 7 Left 1067376010 10:45727853-45727875 CCTGGACTAAATGGGGTGGGAAA 0: 2
1: 1
2: 1
3: 14
4: 133
Right 1067376014 10:45727883-45727905 GTATGTGGATATCCTTTAATGGG No data
1067376010_1067376018 23 Left 1067376010 10:45727853-45727875 CCTGGACTAAATGGGGTGGGAAA 0: 2
1: 1
2: 1
3: 14
4: 133
Right 1067376018 10:45727899-45727921 TAATGGGATTCTTCAAATCGGGG No data
1067376010_1067376013 6 Left 1067376010 10:45727853-45727875 CCTGGACTAAATGGGGTGGGAAA 0: 2
1: 1
2: 1
3: 14
4: 133
Right 1067376013 10:45727882-45727904 AGTATGTGGATATCCTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067376010 Original CRISPR TTTCCCACCCCATTTAGTCC AGG (reversed) Intronic
900638903 1:3678948-3678970 TTTCCCACCCCACATGCTCCTGG + Intronic
902664238 1:17926405-17926427 TCTCCCACCCCACTCAGTCTGGG + Intergenic
905740347 1:40364906-40364928 TTACCCACCTTATTTAGGCCTGG - Intronic
908219983 1:61995793-61995815 TTTCCCAAAGCAATTAGTCCCGG + Intronic
908754241 1:67453463-67453485 TTTCCCACTCCATTTTCTACTGG - Intergenic
911447248 1:98012385-98012407 TTTCCTACCACATTTAGTAGTGG + Intergenic
914898257 1:151696183-151696205 TGTCCTACCCCAATTAGCCCTGG - Exonic
916466783 1:165080970-165080992 TTTGCTACCCCATGTAGACCTGG - Intergenic
916509404 1:165458102-165458124 ATACCCACCTCCTTTAGTCCTGG - Intergenic
918181637 1:182089626-182089648 TTTCCTGCTCCATCTAGTCCTGG + Intergenic
919887479 1:201945515-201945537 TTTCCCAGCCCATAGACTCCTGG + Intronic
1064745016 10:18469897-18469919 TTATCCACCCCAATAAGTCCTGG + Intronic
1066573074 10:36794068-36794090 TTTCCTACCCAATTTAGAACTGG - Intergenic
1066795234 10:39112752-39112774 TTTCGCAGCCCATTGAGGCCTGG + Intergenic
1067364416 10:45611970-45611992 TTTCCTGTCCCCTTTAGTCCTGG - Intergenic
1067376010 10:45727853-45727875 TTTCCCACCCCATTTAGTCCAGG - Intronic
1067883710 10:50068541-50068563 TTTCCCACCCCATTTAGTCCAGG - Intronic
1068043962 10:51862242-51862264 TGTCACAGCTCATTTAGTCCTGG + Intronic
1069038198 10:63667695-63667717 TTTACCACCTCATTTATTTCTGG - Intergenic
1069969328 10:72152366-72152388 TTTTCATCCCCATTTTGTCCTGG + Intronic
1073285083 10:102382694-102382716 TTTCCCACTCCCATTAGCCCTGG + Exonic
1074882158 10:117667732-117667754 TCTCCCACCCCAGTTTCTCCTGG + Intergenic
1075944602 10:126421498-126421520 TTTCCAAAGCCATTCAGTCCCGG + Intergenic
1076001289 10:126915050-126915072 TTTCCCACCCCACTTGCTGCAGG - Intronic
1081347985 11:42013939-42013961 CTTCCCCTGCCATTTAGTCCCGG + Intergenic
1082753063 11:57043274-57043296 TTTCCCCCCCAATTTTGTACTGG - Intergenic
1084278313 11:68068238-68068260 CTGCCTACCCCATTGAGTCCCGG - Intronic
1084312320 11:68324294-68324316 TATCCCACCCCACTAGGTCCCGG - Intronic
1085981792 11:81734487-81734509 TTTTCCACTCCATTTATTCCTGG + Intergenic
1088302050 11:108368731-108368753 TTTCCCACCCTACTTTGTGCAGG + Exonic
1089897790 11:121949476-121949498 TTTCCCAACCCATGTAGCCCTGG + Intergenic
1090266833 11:125358711-125358733 TTCCCCAACCCAGTTAGCCCAGG - Intronic
1094379389 12:29826748-29826770 TTACCCACCCCATTTTCTGCGGG + Intergenic
1094449190 12:30566194-30566216 TTTTTCACCTCATTTAGTACTGG - Intergenic
1096563081 12:52451201-52451223 TTTACCAGCCCATATACTCCTGG + Intronic
1096565233 12:52472861-52472883 TTTACCAGCCCATATACTCCTGG + Intronic
1103209136 12:119154136-119154158 TTTCCCACCCCACTGGGTCACGG - Intronic
1105303316 13:19153579-19153601 TGTCCCGCCCCATCTTGTCCAGG + Intergenic
1105547552 13:21361890-21361912 CTTCCCACCCCATGGAGACCTGG - Intergenic
1106102912 13:26709863-26709885 TTGCCCACGCCCTTTAATCCTGG - Intergenic
1106651782 13:31698701-31698723 TTTCCCACCTCATTTTATTCAGG - Intergenic
1107158140 13:37193720-37193742 TTTGCCACCCCAGTGAATCCTGG - Intergenic
1107178854 13:37432628-37432650 TTTCCTTCCCCATTTTGCCCAGG + Intergenic
1111177215 13:84610963-84610985 TCTCCCACACCATTTTCTCCTGG + Intergenic
1111510112 13:89250215-89250237 TAGCCCACCCCATTTGGTCATGG - Intergenic
1111597277 13:90427905-90427927 GTACCCACCCCTTTTAGCCCAGG - Intergenic
1112687508 13:101847963-101847985 TTTCCTACCACATTTAATACTGG - Intronic
1115245653 14:31291540-31291562 TTGCCCACTCCTTTTAGGCCTGG - Intergenic
1118143944 14:63115835-63115857 GTTCCCACCCCATATAGCCCTGG + Intergenic
1123780504 15:23622275-23622297 CTTCCCACCCCTACTAGTCCGGG + Intronic
1124460161 15:29882618-29882640 TTGCCCAACACATTTAATCCAGG - Intronic
1127708652 15:61573251-61573273 TTTTCAACCTCATTTAGTCATGG + Intergenic
1128410091 15:67387987-67388009 TTTCCCTCCACATTTAGCCAAGG + Intronic
1129947428 15:79551500-79551522 TTTCCCATCCTTTTTAGTTCTGG - Intergenic
1129979896 15:79859078-79859100 TGTGCCTCCCCATTTATTCCAGG - Intronic
1131055499 15:89372127-89372149 ATTCCCACCCCATTTTGCCTAGG + Intergenic
1131408008 15:92182469-92182491 CTACCCACCCCAGTTATTCCAGG + Intergenic
1132504638 16:301412-301434 TTCCCCACCCCATGGAGTCCTGG - Intronic
1133065211 16:3201537-3201559 TATCCTCCTCCATTTAGTCCTGG + Intergenic
1137726900 16:50662795-50662817 TTTCCCTCCCCTTTGAGTCCGGG - Intergenic
1141659237 16:85432912-85432934 TCTGCCACCCCAGTAAGTCCTGG - Intergenic
1141730037 16:85816128-85816150 TTTCCCGCCTTATTTAGGCCTGG + Intergenic
1145932931 17:28698889-28698911 TTTCCAGCCCCACTTAGCCCTGG - Intronic
1146008596 17:29177761-29177783 TTTCCCACCACACTCAGGCCTGG + Intronic
1146008799 17:29178727-29178749 TTCCCCACCCTTTTTAGTTCAGG - Intronic
1148088784 17:45010184-45010206 TTTCCCATCCCATTCAGTGGAGG - Intergenic
1148918341 17:51004086-51004108 TTTCACACTACATTTAGTCTTGG - Intronic
1151284093 17:73097238-73097260 TTGTCCACCCCAATGAGTCCTGG + Intergenic
1151404685 17:73878679-73878701 TTACCCACCTCCTTTGGTCCAGG - Intergenic
1156520147 18:37715290-37715312 TTTCCCATCCCATTGACTCTGGG + Intergenic
1157974979 18:52316645-52316667 ATTCCCACACCATATATTCCTGG + Intergenic
1159642803 18:70883106-70883128 TTTCCCACCCCATCTTTTACAGG + Intergenic
1160051004 18:75433342-75433364 TTCCCCAGATCATTTAGTCCTGG - Intergenic
1161840540 19:6677722-6677744 GTTCCCACCGCATTTTCTCCTGG - Exonic
925142165 2:1558055-1558077 TTTCCCAGGCCAGTGAGTCCTGG + Intergenic
934199806 2:89875134-89875156 TTTTCCCCACCATTTAGCCCTGG - Intergenic
938322761 2:130376093-130376115 TATCTCACACCATTTACTCCGGG + Intergenic
941677554 2:168360101-168360123 TCTCCCATTCCATGTAGTCCTGG - Intergenic
946168723 2:217881009-217881031 TTTCCCATCCCACTTAGGCATGG - Exonic
947734276 2:232446682-232446704 TGTCCCATCCCCCTTAGTCCTGG + Intergenic
1168945871 20:1756961-1756983 TCTGCCACTCCATTTATTCCAGG + Intergenic
1169785302 20:9353689-9353711 ATTCCCACAGCATTTGGTCCAGG - Intronic
1170869146 20:20188527-20188549 TTTCCCAGCCCATGTAATCCTGG - Intronic
1172416668 20:34774630-34774652 TTTCCCTTCCACTTTAGTCCAGG - Intronic
1172782554 20:37445808-37445830 CTTCCCATCCCATCTAGCCCAGG + Intergenic
1172888912 20:38249834-38249856 TTTCCCACCCCATGCAATCCTGG + Intronic
1179897973 21:44373652-44373674 TTTCCCACATCATCAAGTCCTGG + Intronic
1183226918 22:36556792-36556814 CCTCCCACCCCATTCATTCCAGG - Intergenic
1183333270 22:37232563-37232585 CTTCCCACCCCATTGCCTCCTGG - Intronic
1184036910 22:41922706-41922728 TCTCCCACCCCATCTTCTCCTGG - Intergenic
1184036921 22:41922737-41922759 TCTCCCACCCCATCTTCTCCTGG - Intergenic
960191477 3:114711614-114711636 TTTCCCAGCCCAACTGGTCCTGG + Intronic
961063531 3:123853870-123853892 TTTCTCTCCCCATTGAATCCAGG + Intronic
961635093 3:128328257-128328279 CCTCCCACCCCACTTAGGCCTGG - Intronic
961966424 3:130909263-130909285 TTTCCCACCCCATATAGAAATGG + Intronic
964284704 3:155105228-155105250 TTTTCCACCTCATTTGGACCTGG - Intronic
965610983 3:170543689-170543711 TTTCCCAACCCTCTTGGTCCTGG - Intronic
965893395 3:173542945-173542967 TTTCCTACCCCATCATGTCCAGG + Intronic
967466018 3:189806836-189806858 TTTGCCATTCCATTCAGTCCAGG - Intronic
969981644 4:11162692-11162714 TCTCCCATCCCACATAGTCCTGG + Intergenic
971095722 4:23399787-23399809 TTTCCAACCCCATGCAGTGCAGG - Intergenic
971632569 4:29012654-29012676 ATTGGCACCCCTTTTAGTCCCGG - Intergenic
976145679 4:82041044-82041066 TTTCCCACCACTTCTTGTCCCGG + Intronic
976958513 4:90935677-90935699 TTCCCAACCCAATTTAGTCCTGG - Intronic
981061975 4:140434699-140434721 TTTATCACCCCCTATAGTCCCGG - Intergenic
982172944 4:152679430-152679452 TTTCACACCCCAGTTTTTCCAGG + Intronic
982856407 4:160386968-160386990 TTTCCCATTCCTTTTAGTCTGGG + Intergenic
986549348 5:8935540-8935562 GTTCCCTACCCTTTTAGTCCAGG - Intergenic
988936079 5:36083902-36083924 TTTCTCTCCCCATTGAGTGCTGG - Intergenic
993616086 5:90114198-90114220 CTTACCATCCCATTTATTCCTGG - Intergenic
998028540 5:138842715-138842737 TTTCTTAACCCATTTAGGCCTGG - Intronic
998041621 5:138954164-138954186 CTTCCCACCCCATTTAGAGTAGG + Intronic
998514171 5:142737723-142737745 TCTCCCACCCCATTTTCTCCTGG - Intergenic
1003404124 6:5814791-5814813 TTTCCCACCCCATGGAGACCTGG + Intergenic
1003933198 6:10948343-10948365 TTTCCCAACCCCTTGATTCCTGG + Intronic
1004257963 6:14082440-14082462 TTTCACACTCCATTTATTCAAGG - Intergenic
1006954591 6:37856539-37856561 TTTCCCCTTCCATTTAGTCAGGG + Intronic
1007256023 6:40529260-40529282 TTTCCCTTCCCATTCAGTCCAGG - Intronic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1012447650 6:99322944-99322966 TTTCTCACCCCTCTTATTCCTGG - Intronic
1014204378 6:118641150-118641172 TTTCCCTCCCTATTTAATCAAGG + Intronic
1014527041 6:122513219-122513241 TTTCCCACACCATTTAGGCCAGG + Intronic
1019270525 7:144599-144621 TTTCCCACCCCATTCACCCAGGG + Intergenic
1022819953 7:33950036-33950058 TATCTCAACCCATTTATTCCTGG + Intronic
1024596532 7:50942020-50942042 TTTCCCACCCCACTTAGCTTGGG - Intergenic
1025598776 7:62967771-62967793 TTTCCTACCACTTTTAGTCCTGG - Intergenic
1031226287 7:119041964-119041986 ATTCCCACCCCATTCTGTCCAGG + Intergenic
1031251455 7:119388452-119388474 TTTCCCAACCAATTAATTCCTGG + Intergenic
1031768785 7:125815523-125815545 CTTCCCACACAATTTATTCCAGG - Intergenic
1032983038 7:137306847-137306869 TTTCCCACCACATTTAGTCCTGG - Intronic
1032999270 7:137485011-137485033 TTTCTCATCCCATTTGGTCATGG - Intronic
1035659222 8:1334273-1334295 TTTGCCACCCCATGCAGCCCTGG + Intergenic
1038233495 8:25728695-25728717 TTTCTCTCCCCCTTAAGTCCAGG + Intergenic
1040817318 8:51522176-51522198 ATTCCCATTCCATATAGTCCAGG - Intronic
1042588546 8:70370851-70370873 ATTCACACACCATTTATTCCTGG - Intronic
1047782341 8:128120263-128120285 TTTCCCATCCCTTTTAATCTGGG + Intergenic
1050406142 9:5310211-5310233 TTTTGCACCCTATTTAGTTCTGG + Intergenic
1050838696 9:10117994-10118016 TTTCCTACCACATTTTTTCCAGG - Intronic
1050862108 9:10448175-10448197 TTTTCCACCCTATTTAGTTATGG - Intronic
1055529614 9:77171016-77171038 TTTCCCACCCCACTCCATCCTGG + Intergenic
1056013786 9:82360557-82360579 CTTCCCACCCCATCTCATCCTGG + Intergenic
1060985421 9:127816632-127816654 TTTGCCACCCCATCCAGGCCAGG - Intronic
1186525083 X:10241075-10241097 TTTCCAAACCCCTTTAGTCAGGG + Intergenic
1187499349 X:19826344-19826366 TTGCTCACAACATTTAGTCCTGG - Intronic
1187616108 X:20995178-20995200 TTTCACACTCCAAATAGTCCTGG - Intergenic
1187660814 X:21544998-21545020 TTTCCTACCCCATTGACACCTGG + Intronic
1189773941 X:44453256-44453278 TTTCCTATCCCATTTAGTTCAGG - Intergenic
1193131413 X:77924026-77924048 TTTCCCACCCCATTTTAGACAGG - Intronic
1197409138 X:126094997-126095019 TCTTCCACCCCATTAATTCCTGG + Intergenic
1198383577 X:136106368-136106390 TCTCCATCCCCATTTAGTCTTGG - Intergenic
1202044683 Y:20726597-20726619 ATGCCCACACCATTTAGGCCTGG - Intergenic