ID: 1067380135

View in Genome Browser
Species Human (GRCh38)
Location 10:45765332-45765354
Sequence CAGGTGGTTACAGCCTGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 2, 1: 0, 2: 2, 3: 3, 4: 88}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067380135_1067380143 19 Left 1067380135 10:45765332-45765354 CCATCGCAGGCTGTAACCACCTG 0: 2
1: 0
2: 2
3: 3
4: 88
Right 1067380143 10:45765374-45765396 TGCCCACAGGGTGACTGGATGGG No data
1067380135_1067380139 6 Left 1067380135 10:45765332-45765354 CCATCGCAGGCTGTAACCACCTG 0: 2
1: 0
2: 2
3: 3
4: 88
Right 1067380139 10:45765361-45765383 GCAGAGAGGCACTTGCCCACAGG No data
1067380135_1067380136 -8 Left 1067380135 10:45765332-45765354 CCATCGCAGGCTGTAACCACCTG 0: 2
1: 0
2: 2
3: 3
4: 88
Right 1067380136 10:45765347-45765369 ACCACCTGAAATGAGCAGAGAGG No data
1067380135_1067380140 7 Left 1067380135 10:45765332-45765354 CCATCGCAGGCTGTAACCACCTG 0: 2
1: 0
2: 2
3: 3
4: 88
Right 1067380140 10:45765362-45765384 CAGAGAGGCACTTGCCCACAGGG No data
1067380135_1067380141 14 Left 1067380135 10:45765332-45765354 CCATCGCAGGCTGTAACCACCTG 0: 2
1: 0
2: 2
3: 3
4: 88
Right 1067380141 10:45765369-45765391 GCACTTGCCCACAGGGTGACTGG No data
1067380135_1067380142 18 Left 1067380135 10:45765332-45765354 CCATCGCAGGCTGTAACCACCTG 0: 2
1: 0
2: 2
3: 3
4: 88
Right 1067380142 10:45765373-45765395 TTGCCCACAGGGTGACTGGATGG No data
1067380135_1067380144 20 Left 1067380135 10:45765332-45765354 CCATCGCAGGCTGTAACCACCTG 0: 2
1: 0
2: 2
3: 3
4: 88
Right 1067380144 10:45765375-45765397 GCCCACAGGGTGACTGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067380135 Original CRISPR CAGGTGGTTACAGCCTGCGA TGG (reversed) Intronic
904532695 1:31180003-31180025 CTGGTGGGTACAGCTTGAGAGGG - Exonic
909359177 1:74742244-74742266 CAGGTAGTCAAAGCCTGTGAGGG - Intronic
912354165 1:109041775-109041797 CAGGTGGTGACAGGAGGCGACGG + Intronic
915559430 1:156677685-156677707 CAGGACGTTCCAGCCTGGGAGGG + Intergenic
921213460 1:212918757-212918779 TAGGTGGCCACAGCCTTCGAAGG - Intergenic
1064130738 10:12707511-12707533 CAGGTGGCCAAAGCCTGCGGAGG + Intronic
1067373554 10:45706887-45706909 CAGGTGGTTACAGCCTGCGATGG + Intergenic
1067380135 10:45765332-45765354 CAGGTGGTTACAGCCTGCGATGG - Intronic
1067881376 10:50048658-50048680 CAGGGGGTTACAGCCTGCAACGG + Intergenic
1067887834 10:50105987-50106009 CAGGGGGTTACAGCCTGCAATGG - Intronic
1073645082 10:105293561-105293583 CTGGTGGTGACAGCCTGCAGTGG - Intergenic
1074826510 10:117218808-117218830 CAGTTGGTTACACCCTGTGAAGG + Intergenic
1081632359 11:44698394-44698416 CAGGGGCTTGCAGCCTGCGCAGG + Intergenic
1094739873 12:33276016-33276038 CAGGTACTCACAGCCTGTGAAGG - Intergenic
1097089036 12:56490663-56490685 CAGGTGGTTAAAGCTTGGCAGGG + Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1097397894 12:59098273-59098295 AAGGTGTTTACAGCCAGGGAAGG + Intergenic
1103201415 12:119090996-119091018 CAGGAGCTCACAGCCTGCCATGG + Intronic
1104811266 12:131621579-131621601 CAGGGGGTTCCAGCCTGCAGCGG + Intergenic
1108615411 13:52127998-52128020 CAGGTGGTTGGGGCCTGAGATGG + Intronic
1111062749 13:83044939-83044961 CAGGTGTTTGCATCCAGCGAGGG - Intergenic
1113441299 13:110330693-110330715 CATGTAGATACAGCCTGGGAAGG - Intronic
1113547722 13:111167057-111167079 CAGGTGGTTACAGCTTGGCCAGG - Intronic
1116437973 14:44915111-44915133 CAGTTGGTTACACCCTATGAAGG - Intergenic
1121819672 14:96956178-96956200 CAGGTGATTACGGCCTGTGCTGG - Intergenic
1122197131 14:100096762-100096784 CAGGTGCTTACAAGCTGCTAGGG - Intronic
1122214536 14:100194106-100194128 CAGGAGGTTGCAGCCAGAGATGG - Intergenic
1127046297 15:55029102-55029124 CAGCTGGTTACAGCATTTGATGG + Intergenic
1130866551 15:87938186-87938208 AAGGTGCTTACAGCCTGCTGGGG - Intronic
1132535631 16:478129-478151 CAGGTGGGTGCAGCCTGGGGTGG + Intronic
1132649957 16:1016121-1016143 CAGGGGGTGACATCCTGCGGGGG + Intergenic
1132688744 16:1172966-1172988 CAGGTGGGTGCTGCCTGGGAGGG + Intronic
1134214708 16:12308088-12308110 CAGTAGCCTACAGCCTGCGAGGG + Intronic
1134790202 16:16982826-16982848 CAGTTGGTTACACCCTTTGAAGG - Intergenic
1138030151 16:53553284-53553306 CAGGTGGTTAGGGCCAGTGAGGG + Intergenic
1149287151 17:55177295-55177317 CAGGGTGTTACAGCCAGAGAAGG - Intergenic
1149788593 17:59457413-59457435 CAGGTGGCTGCAGCATGCCATGG + Intergenic
1150863784 17:68827900-68827922 AAGGTGGTTACAGGCTGAGCGGG - Intergenic
1153473576 18:5472408-5472430 CATTTGGTTACAGCACGCGATGG + Intronic
1156503456 18:37574474-37574496 CAGGCTGTTAGAACCTGCGATGG + Intergenic
1156946804 18:42843477-42843499 CAGGTGGTCACACCCTGGAAGGG - Intronic
1161284539 19:3462592-3462614 CAGGTTGTTAGAGCCTGGGATGG + Intronic
1165324938 19:35109035-35109057 CAGGTGGGAACAGACTGCGGTGG + Intergenic
1166625858 19:44355576-44355598 CAGGTGGTAAGAGCCTGAGCTGG - Intronic
1167222134 19:48206577-48206599 CAGTTGGTTACACCCTATGAAGG - Intronic
1168667866 19:58218082-58218104 CAGGTGGTCACAGGCTCCTAGGG + Intergenic
930019394 2:46992274-46992296 CAGGTGGCCACAGTGTGCGAGGG + Intronic
930064825 2:47319855-47319877 CAGGTGGGTGCAGCCGGGGATGG - Intergenic
942595659 2:177589630-177589652 CATGTGGTTTCAGCCAGCCATGG - Intergenic
943585561 2:189735205-189735227 CAGGTGGTAACAAACTGGGAAGG - Intronic
1173476639 20:43364381-43364403 CAGTTGGTTACACCCTATGAAGG - Intergenic
1175837882 20:62008026-62008048 CAGGAGGTCACAGCGTGCCAGGG + Intronic
1176164008 20:63663496-63663518 CACGTGGCCACAGCCTGTGAGGG + Intronic
1182461794 22:30488676-30488698 CAGTTGGCCACAGCCTGCCATGG + Intergenic
1182662282 22:31933487-31933509 CCTGTGTTGACAGCCTGCGATGG + Intergenic
1184678348 22:46055350-46055372 CAGGTTGCTCCAGCCTGCGGTGG + Intronic
950863052 3:16167437-16167459 CATGTGGATCCAGCCTGCTAGGG - Intergenic
955774195 3:62415930-62415952 CAGGAGGTTGCAGCCTCCCAAGG - Intronic
959452583 3:106522218-106522240 CAGGAGGCTACAGCCTAGGAAGG - Intergenic
969029153 4:4197428-4197450 CGGGTGGTCACAGTCTGCAATGG - Exonic
981374341 4:143996396-143996418 CAATTGGCTACAGCCTGTGAAGG - Intronic
985299515 4:188472962-188472984 CAGATGGTTACAGCCTCCTTCGG + Intergenic
985921897 5:2984047-2984069 CAGGTGGTGACACCCAGCAAGGG + Intergenic
986129835 5:4919231-4919253 CAGTTGGTTACACCCTAGGAAGG + Intergenic
986998929 5:13638980-13639002 GAGTTGGTTATAGCCTGAGAGGG - Intergenic
989630565 5:43477892-43477914 CAGATGGTTTCAACCTACGATGG + Intronic
995756002 5:115504819-115504841 CTGGTGGTTACAGCCTTAGTGGG - Intergenic
998758186 5:145403561-145403583 CAGGTGTTTTGAGCCTGGGAAGG - Intergenic
1003120737 6:3317316-3317338 CAGGTGGCCACAGCCTGCACTGG - Intronic
1003243026 6:4361083-4361105 CAGGAGTTTACAGCCTGCAAAGG + Intergenic
1004063840 6:12223722-12223744 CAGTTGGCTACGGCCTCCGAGGG - Intergenic
1018748717 6:166782669-166782691 CAGATGGCTACAGCCTGCTCTGG + Intronic
1019778799 7:2927860-2927882 CGGGTGTTTCCAGCCTGCCAGGG - Intronic
1020108991 7:5437479-5437501 CAGGTGGCTTCAGCCTGAGGTGG + Intronic
1021192785 7:17641799-17641821 CAGGTGGTGACAGGCAGAGACGG - Intergenic
1023159043 7:37279695-37279717 CAGGTGGTAATGGCCTGCTAGGG - Intronic
1025611931 7:63082113-63082135 CAGATGGTTACAGGCTGTTAGGG - Intergenic
1027555996 7:79665426-79665448 CAATTGGTTACACCCTGTGAAGG + Intergenic
1036079752 8:5542226-5542248 CAGGTGGTTGCAGGCTCCCAAGG + Intergenic
1036202170 8:6778893-6778915 CAGGTGGATGCACCCTTCGATGG - Intergenic
1036210436 8:6836029-6836051 CATGAGGATACAGCCTGGGATGG - Intergenic
1036235635 8:7037082-7037104 CAGTTGGAGACAGCCTGGGAGGG + Intergenic
1040292267 8:46131583-46131605 CTGGTGTTTACAGCCTGCCCAGG + Intergenic
1040314141 8:46252031-46252053 CTGGTGCTTACAGCCTGCCCAGG - Intergenic
1040340448 8:46437827-46437849 TGGGTATTTACAGCCTGCGAGGG + Intergenic
1045108992 8:98921574-98921596 CAAGTTGTTACAGCCTATGATGG + Intronic
1056794309 9:89647185-89647207 CAGGGGGTTACCAACTGCGAAGG - Intergenic
1060751046 9:126169757-126169779 GAGGTGCTTACAGGCTGGGAGGG + Intergenic
1061190369 9:129079260-129079282 CAGGTGGTTACAGCCACCACTGG - Intergenic
1061764846 9:132875222-132875244 CAGGTGGTTAATACCTGCAAGGG + Intronic
1062319265 9:135982461-135982483 CAGGTGGTGAGAGCCAGAGATGG + Intergenic
1187153828 X:16705783-16705805 CAGGCTGTAACAGCCTGCAAAGG - Intronic
1190384211 X:49868625-49868647 CACTTTGTTACAGCCTGCCAAGG + Intergenic
1190935333 X:54994416-54994438 CATGTGCTTACAGCCTGTGTGGG + Intronic
1199634613 X:149803627-149803649 CAGGTGTTTAAAACCTGCCAGGG + Intergenic