ID: 1067393815

View in Genome Browser
Species Human (GRCh38)
Location 10:45892425-45892447
Sequence CACCTACCTGTAGCATGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067393814_1067393815 1 Left 1067393814 10:45892401-45892423 CCATACACAGACACTACTAAGAT No data
Right 1067393815 10:45892425-45892447 CACCTACCTGTAGCATGCCTCGG No data
1067393813_1067393815 6 Left 1067393813 10:45892396-45892418 CCTAACCATACACAGACACTACT No data
Right 1067393815 10:45892425-45892447 CACCTACCTGTAGCATGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067393815 Original CRISPR CACCTACCTGTAGCATGCCT CGG Intergenic
No off target data available for this crispr