ID: 1067394040

View in Genome Browser
Species Human (GRCh38)
Location 10:45895465-45895487
Sequence CTACACTTCTTTAAGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067394039_1067394040 2 Left 1067394039 10:45895440-45895462 CCTCAAACATATTTAAAAAGTTA 0: 8
1: 0
2: 6
3: 115
4: 1088
Right 1067394040 10:45895465-45895487 CTACACTTCTTTAAGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067394040 Original CRISPR CTACACTTCTTTAAGTGTCC TGG Intergenic
No off target data available for this crispr