ID: 1067394616

View in Genome Browser
Species Human (GRCh38)
Location 10:45903045-45903067
Sequence GGGGAGAAGAAAGATGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067394611_1067394616 -5 Left 1067394611 10:45903027-45903049 CCCAAGAAACGGGTGAAGGGGGA 0: 2
1: 0
2: 1
3: 8
4: 127
Right 1067394616 10:45903045-45903067 GGGGAGAAGAAAGATGGGGCAGG No data
1067394612_1067394616 -6 Left 1067394612 10:45903028-45903050 CCAAGAAACGGGTGAAGGGGGAG 0: 2
1: 0
2: 0
3: 4
4: 173
Right 1067394616 10:45903045-45903067 GGGGAGAAGAAAGATGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067394616 Original CRISPR GGGGAGAAGAAAGATGGGGC AGG Intergenic
No off target data available for this crispr