ID: 1067401226

View in Genome Browser
Species Human (GRCh38)
Location 10:45975637-45975659
Sequence CTGGTGTTTGTGAGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 2, 1: 0, 2: 1, 3: 37, 4: 334}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067401226 Original CRISPR CTGGTGTTTGTGAGGAAAAA AGG (reversed) Intronic
901956483 1:12789250-12789272 CAGGAGTTTGTGAGGAATATGGG - Intergenic
901979865 1:13025305-13025327 CAGGAGTTTGTGAGGAATATGGG - Intronic
902002218 1:13203633-13203655 CAGGAGTTTGTGAGGAATATGGG + Intergenic
902021451 1:13349396-13349418 CAGGAGTTTGTGAGGAATATGGG + Intergenic
902650995 1:17837552-17837574 ATGGTGTGTGTGAGGAACACTGG + Intergenic
907069217 1:51519052-51519074 CCGGTGTGTGTGAGGGAAAGCGG - Intronic
909500670 1:76331663-76331685 CTGGAGGTGGTGAGGAAAACAGG - Intronic
910174808 1:84417955-84417977 CTGGTGATGATGAGGAGAAAGGG - Intergenic
910487057 1:87726480-87726502 CTGGAGTTTATGAGGGATAATGG + Intergenic
910822284 1:91364297-91364319 CAGGTGATGGTGTGGAAAAAAGG + Intronic
911256413 1:95638430-95638452 CTGGTGTTTGAAGGGAACAAAGG - Intergenic
915984048 1:160445690-160445712 TTGGTGTTTGTGAGTAACAACGG + Intergenic
916245213 1:162680995-162681017 CTTGTTTTTGTGAGGAAGCATGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918911523 1:190578291-190578313 CTGTTGTTTGTGTGAAAAATCGG + Intergenic
920159678 1:203986772-203986794 ATGGTGTTTGAGAGAAAGAAAGG + Intergenic
921548289 1:216500419-216500441 CTGGTATCTGTAATGAAAAAGGG + Intergenic
921815055 1:219554071-219554093 CTGGATTTTGGGAGGTAAAAGGG + Intergenic
922244615 1:223783392-223783414 CTGCTGTTGGTGAGGAAGTAAGG - Intronic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
923260240 1:232261385-232261407 CTGGTGCTTTTGAGGAAAACTGG - Intergenic
923699295 1:236284394-236284416 CAGGTGTTTGTCATGAAATAGGG + Intergenic
1063125409 10:3132690-3132712 CTGATGTTTATGAAGAAAGAAGG + Intronic
1063576207 10:7264111-7264133 TTGGTTTGTGTGGGGAAAAATGG + Intronic
1063840603 10:10067763-10067785 CTGGTCTTTAAGGGGAAAAATGG - Intergenic
1063939455 10:11111960-11111982 CTGGTTTTTGTAAGGAAAACAGG + Intronic
1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1066966479 10:42270944-42270966 CTGCTTTTGGTGAAGAAAAAAGG - Intergenic
1067025306 10:42838813-42838835 CTGGGGGTTGTGAGGAACAAGGG + Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067464953 10:46490906-46490928 CTGGTGGTGGGGAGGAAAGATGG - Intergenic
1067622236 10:47893695-47893717 CTGGTGGTGGGGAGGAAAGATGG + Intergenic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1068244993 10:54353777-54353799 CTAGTCTTTGTGATAAAAAATGG - Intronic
1070218884 10:74419189-74419211 CTGTTGTTGGGGAGGAAGAATGG - Intronic
1071240441 10:83699106-83699128 CTGGTGGATGTGGGGAGAAAGGG + Intergenic
1072340056 10:94438628-94438650 GTGGTGGTTGTGAGGAATAGGGG + Intronic
1072603777 10:96959328-96959350 CTGGAAAATGTGAGGAAAAACGG - Intronic
1074125939 10:110529095-110529117 CAGCTGTTTGAAAGGAAAAAAGG - Intergenic
1074627648 10:115210488-115210510 CTGGTGGTTGTGAGGAGCCAGGG - Intronic
1074733444 10:116402058-116402080 CTGCTGCTTGTCATGAAAAAAGG + Intergenic
1074986127 10:118661519-118661541 GTGGTGTTCCTGAGGAAGAAGGG - Intergenic
1075250187 10:120861955-120861977 CTGATGCTTGAGAAGAAAAAGGG + Intronic
1078911523 11:15737044-15737066 CTGATGTTTATGAGGAATCAAGG - Intergenic
1079162846 11:18011086-18011108 GGAGTGTTTGTGAGGAAGAAAGG - Intronic
1079240753 11:18720870-18720892 CTTCTGTCTGTGGGGAAAAAAGG + Intronic
1079420836 11:20286146-20286168 CTGGTGTGGATGAGGAGAAAAGG - Intergenic
1079734111 11:23973962-23973984 CAGGAATTTATGAGGAAAAAGGG + Intergenic
1080835311 11:35935201-35935223 CTGGTGTTTGGGATCAAAAAGGG - Intergenic
1081047815 11:38297722-38297744 ATGGTGTTTGTAAGGTTAAAAGG + Intergenic
1081491731 11:43574775-43574797 CTGGTCTTTGAGAGGGAGAAAGG + Intronic
1081830327 11:46105593-46105615 ATGGTGTTTGGGAAGAAGAAGGG - Intronic
1081857543 11:46313095-46313117 CAGGTGTAGGTGAGGAAAAATGG - Intronic
1082249673 11:49964301-49964323 CTGGTGATACTGAGGAAAACAGG + Intergenic
1083009323 11:59381218-59381240 TTGGTATTCCTGAGGAAAAAAGG - Intergenic
1083281598 11:61630075-61630097 CTGGTGTTTGTCAGGAGAGTGGG - Intergenic
1083432722 11:62622700-62622722 CTTGTGCTTGTGAGGAGGAAGGG - Intergenic
1083624048 11:64062908-64062930 CAGGTGTTTGTGGGGAATGAAGG - Intronic
1084070856 11:66733416-66733438 GGGGTGGTGGTGAGGAAAAAGGG + Intergenic
1085482132 11:76831322-76831344 CTGGTCATTGGCAGGAAAAAAGG + Intergenic
1086244775 11:84739700-84739722 CTGGCAGATGTGAGGAAAAATGG - Intronic
1087736385 11:101839181-101839203 CTGGGCTTTGTGAGGACAAAAGG - Intronic
1088606007 11:111532897-111532919 CTGGTGTATTTGAGAAAAAAAGG - Intronic
1088737597 11:112740475-112740497 TTGGTGTTTGTGAAGGAGAATGG + Intergenic
1088846725 11:113674396-113674418 CTGGTCATTGTGGGGAAGAATGG - Intergenic
1090184969 11:124732121-124732143 CTGCTGTTTATGAGGAATTAAGG - Intergenic
1090266045 11:125353539-125353561 CTAGCCTTTGTGAGGAAGAAGGG + Intronic
1090959881 11:131546784-131546806 TTGGGGTTTGTGAGGAAAGCAGG + Intronic
1091660619 12:2380608-2380630 CTTGTGTATGTGATGAAAGAGGG - Intronic
1093246580 12:16745588-16745610 CTGGTGAGGATGAGGAAAAAAGG + Intergenic
1093569715 12:20653120-20653142 CAAATGTTTCTGAGGAAAAAAGG - Intronic
1093824584 12:23668087-23668109 CTAGTGTTTATGAGGCAAGAGGG + Intronic
1094237052 12:28180385-28180407 ACTGTGTTTTTGAGGAAAAAAGG - Intronic
1094687913 12:32737091-32737113 CTTGTGTTTCTTAGGAACAAAGG + Exonic
1095130668 12:38538546-38538568 CTGGTCGTTATGAGGAACAATGG + Intergenic
1096083190 12:48847150-48847172 CAGGTGATTGTGAGATAAAATGG - Intronic
1096420760 12:51455415-51455437 CTGGAAGTTGTGTGGAAAAAAGG + Intronic
1097223300 12:57462513-57462535 CTGGAGTTTGAAAAGAAAAACGG + Intronic
1097851141 12:64411538-64411560 CTGCTTTTTGTCAGTAAAAATGG + Intronic
1098117509 12:67195640-67195662 AAGGTGTTGGTCAGGAAAAATGG + Intergenic
1098172602 12:67761953-67761975 CTGATGTTTGTTGTGAAAAATGG + Intergenic
1098368306 12:69730380-69730402 ATTGTGTTTGTGAGGCAAAATGG - Intergenic
1098519200 12:71416704-71416726 CTGGGGCCTGTGATGAAAAATGG + Intronic
1098694508 12:73536161-73536183 GTGGTGTGTGTGAGAAGAAATGG - Intergenic
1099832650 12:87865046-87865068 TTGTTGTTTCTGAGGAAGAAAGG - Intergenic
1100724005 12:97389260-97389282 ATGGTTTGTGTGAGGATAAAAGG - Intergenic
1102996922 12:117358518-117358540 CTGGTGATTGTAAGGAAGGAAGG - Intronic
1103475722 12:121217135-121217157 TGGGTGTTTGTGTGGGAAAAGGG + Exonic
1104110685 12:125701149-125701171 ATGGTGGTTGTGATGACAAATGG + Intergenic
1104160012 12:126169070-126169092 CTGGTGTGTGTGTAGAAAAAAGG - Intergenic
1104642398 12:130475843-130475865 CAGGTGTTGGTGAGGACAGAGGG + Intronic
1104742229 12:131186452-131186474 CTGGTGTGAATGTGGAAAAAGGG + Intergenic
1106109965 13:26768107-26768129 CTATTGTTTGGGAGTAAAAAGGG + Intergenic
1106133976 13:26960899-26960921 CAGGTGGCTGTGAGGGAAAACGG - Intergenic
1106862485 13:33924751-33924773 CTGGTGATTGAGGGGAAAATGGG + Intronic
1108089652 13:46835219-46835241 ATGATGTTTGTGATGAAGAAAGG + Exonic
1110168712 13:72474514-72474536 CTGGAGTTTGAGGGGAACAAAGG + Intergenic
1110860943 13:80343555-80343577 CTGGAGATTGTGAGGAAAGGGGG - Intergenic
1111645730 13:91029855-91029877 TTAGTGTTTGTCAGGAAAAAGGG - Intergenic
1112810244 13:103209837-103209859 CCTGTGTTTGTGATGAGAAAGGG + Intergenic
1114257233 14:21013509-21013531 CTGATGTTAGTGAGGAGAGAGGG + Intergenic
1114687038 14:24543027-24543049 CTAGTGTTTGTGTGAAATAAAGG - Intergenic
1116226498 14:42160416-42160438 CAGGTGCTTGTGAGGGTAAAGGG - Intergenic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1117400794 14:55356984-55357006 CTAGCTTTTTTGAGGAAAAACGG - Intronic
1119080582 14:71689844-71689866 CTGGTGTCTGTAAGGAAGGAGGG - Intronic
1119220291 14:72900972-72900994 CTGGTGTTAGTGAGGGAGAAGGG - Intergenic
1121125541 14:91404338-91404360 CTGGTGTATGTGATGGAGAAGGG + Intronic
1121670182 14:95703398-95703420 CTGGACTTTGTGAGGAGAATTGG - Intergenic
1121745687 14:96288966-96288988 GTGGTGTTTCAGGGGAAAAATGG + Intronic
1121773466 14:96573679-96573701 AAGGTGATTGTGAGGATAAAAGG + Intergenic
1123425933 15:20170267-20170289 CTGGGGGTTGTGAGGAACAAGGG + Intergenic
1123535165 15:21176791-21176813 CTGGGGGTTGTGAGGAACAAGGG + Intergenic
1123786862 15:23683333-23683355 CAGGTGTTTGTGAAGAAATGAGG + Intergenic
1124932239 15:34131936-34131958 ATGGTTGTTGTGAGGACAAAAGG + Intergenic
1125780034 15:42257107-42257129 ATTGTTTTTGTGAGGAAAGATGG + Intronic
1126678545 15:51182773-51182795 CTTTTGTTGGTGAGGAAGAAAGG + Intergenic
1126845931 15:52760669-52760691 TTGGTATTTGTGAGGCAAGAGGG + Intronic
1127025423 15:54799952-54799974 CTGCAATTTGTGGGGAAAAAAGG - Intergenic
1127470025 15:59282488-59282510 CTGGAGTTTGTGAGGGAAAGAGG - Intronic
1127607028 15:60596692-60596714 CTGCTGTTTATGAGTATAAAGGG + Intronic
1128259682 15:66224248-66224270 CTGATGTGTGTGTGGATAAAAGG + Intronic
1128993584 15:72280397-72280419 ATGGTGTTTGAAAGGAGAAATGG - Intronic
1130677569 15:85967202-85967224 CATGTGTTTGTGAGGCTAAATGG + Intergenic
1131531737 15:93199592-93199614 CTGGTGTTTCTCAGTAAGAAAGG + Intergenic
1132215216 15:100057394-100057416 CTGGTCTTTGTGAGAGAAATGGG - Intronic
1134414890 16:14034695-14034717 CTGGTGTTTTGGAGGAAATTTGG - Intergenic
1135121409 16:19769573-19769595 CTGGAGTGTGTGAGGACATAGGG + Intronic
1136858319 16:33679251-33679273 CTGGGGGTTGTGAGGAACAAGGG - Intergenic
1138336148 16:56254406-56254428 CAGATGTTTGTGATGATAAAAGG - Intronic
1139523754 16:67500440-67500462 CTGGTGGTTGTTGGGAAAAGTGG + Intergenic
1139652148 16:68367879-68367901 CTATTGTAGGTGAGGAAAAAGGG + Intronic
1140305434 16:73798424-73798446 AAGGTGCATGTGAGGAAAAAAGG + Intergenic
1203119888 16_KI270728v1_random:1527721-1527743 CTGGGGGTTTTGAGGAACAAGGG - Intergenic
1143495982 17:7312840-7312862 CTGGTGGTGGTGATGAAAAGAGG + Intronic
1144071186 17:11672504-11672526 CTGGTGATTTTGAGGGAAGATGG - Intronic
1145290779 17:21544090-21544112 ATGTTGCTTGTTAGGAAAAAAGG - Intronic
1146108150 17:30062183-30062205 CTTGTCTTTGTGAGGGAAACAGG - Intronic
1147508568 17:41045684-41045706 CTGGTGTGGATGTGGAAAAAAGG + Intergenic
1149392721 17:56208209-56208231 CTGGTGTTGGTCAGGTAACATGG - Intronic
1152158407 17:78650292-78650314 CTGGTATTTGGGGGGAAAACAGG + Intergenic
1152171457 17:78752235-78752257 TTAGAGCTTGTGAGGAAAAAGGG + Intronic
1152266993 17:79301007-79301029 GAGGTGATGGTGAGGAAAAAGGG - Intronic
1155008884 18:21755289-21755311 CTTTTGTTTCTGAGGGAAAATGG + Intronic
1156883242 18:42105455-42105477 CTAGTGTTTTTGCAGAAAAATGG + Intergenic
1156967064 18:43107141-43107163 CTGGTTTATGGGAGGCAAAATGG + Intronic
1157211380 18:45745416-45745438 CTGGTGCATCTAAGGAAAAAGGG + Intronic
1157238271 18:45984357-45984379 CTGCTGTTTGTGAGTGAAAAAGG + Exonic
1157541003 18:48506571-48506593 TTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1157948668 18:52009889-52009911 CTGGTTTATTTGAGGCAAAATGG - Intergenic
1158406732 18:57166386-57166408 CAGGTGCTTCAGAGGAAAAATGG + Intergenic
1158516789 18:58137509-58137531 CTTGTGTTTGAGAGGATAACAGG + Intronic
1159402062 18:67951561-67951583 GTGAGTTTTGTGAGGAAAAATGG + Intergenic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1161712387 19:5856307-5856329 CGGCTGTGTGTAAGGAAAAAGGG - Intergenic
1161814955 19:6494386-6494408 CTGGTGCCTGTGAGGAAGAGAGG - Exonic
1168106781 19:54170371-54170393 CTTGTATTTGTGAGGAAAAAGGG + Intronic
925170815 2:1749348-1749370 CTGGTGTTTGTGGAGAGAAGGGG - Intergenic
927340165 2:21974126-21974148 CTGATGAATGTGAGGAGAAATGG - Intergenic
927387776 2:22555880-22555902 CTGGTCTTTGTCAAGAAAATGGG - Intergenic
927826407 2:26312778-26312800 GTGGTGTCTGAGAGGAGAAATGG + Intronic
929282955 2:40102617-40102639 CAGCTGTCTGTGAGGAAGAAAGG + Intronic
930808863 2:55519944-55519966 CTGGTGTGAGAGAGGAGAAAAGG - Intronic
930871675 2:56177473-56177495 CTGTTGTTTGTAAAGAAAATTGG - Intergenic
931446509 2:62331460-62331482 CAGGTATTGGAGAGGAAAAATGG + Intergenic
931470274 2:62532299-62532321 CTGGTGTTTATGAGCCTAAATGG + Intergenic
932733032 2:74233799-74233821 CTGGGGTTTGTCAGGAAACATGG + Intronic
932774946 2:74522766-74522788 CTGGAGCTGGTGAGGAAACAGGG + Exonic
933372801 2:81438603-81438625 CTTATGTAAGTGAGGAAAAAAGG + Intergenic
933982777 2:87566905-87566927 CTGGTGTTTTGGGGAAAAAATGG - Intergenic
934313571 2:91894325-91894347 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
935263249 2:101372990-101373012 CAAGTGTTGGTGAGGACAAAGGG + Intronic
935793739 2:106618938-106618960 GTGGTTTCTGTGACGAAAAATGG + Intergenic
936154778 2:110040622-110040644 ATGCTCTTTGTGAGGAACAAAGG + Intergenic
936189905 2:110330792-110330814 ATGCTCTTTGTGAGGAACAAAGG - Intergenic
937000585 2:118463277-118463299 CTGGCAATTGTGTGGAAAAATGG + Intergenic
937642894 2:124233894-124233916 CTGGTGTTTTTGAGTTTAAAAGG - Intronic
937921048 2:127131122-127131144 CTGAAGTATGTCAGGAAAAAAGG - Intergenic
938154469 2:128920883-128920905 GTGGTGTTTCTGAGGAGGAATGG + Intergenic
938955854 2:136297510-136297532 TTGGTGCTTGGGAGGAAAGAAGG + Intergenic
941558722 2:167017423-167017445 CTGATGAGTGTGAGGAGAAAGGG - Intronic
944609306 2:201384838-201384860 CTGTTCTGTGTGATGAAAAATGG + Intronic
948356188 2:237379412-237379434 CTGGTGTTTGTGAGACATATTGG + Intronic
1168910857 20:1445567-1445589 CTGGTATTTAGGAGGAAGAACGG + Intronic
1170362030 20:15556873-15556895 TTGATGTGTGTTAGGAAAAAGGG + Intronic
1170408297 20:16062762-16062784 CTGGTATTTGAGAGGAAGGAAGG - Intergenic
1170536456 20:17345832-17345854 CAGGTGTGTGTGATGAAAACGGG - Intronic
1170877980 20:20268278-20268300 CTGGTGTTTGTTAGGATTCAGGG - Intronic
1170964426 20:21053327-21053349 CTGGTGTTTAAAAGGAAAAGGGG - Intergenic
1172556319 20:35844524-35844546 GTGGTGATGGTGAAGAAAAATGG - Intronic
1172840462 20:37900165-37900187 CTGGTGGTTCTGAGGATTAAGGG + Intergenic
1172925069 20:38526483-38526505 CTGATGTGTTTGAGAAAAAAAGG - Intronic
1173306759 20:41857911-41857933 TTGGTATGTCTGAGGAAAAAAGG + Intergenic
1175973968 20:62701154-62701176 CTGATGTTTTGGAGGAAACAGGG - Intergenic
1178632252 21:34272609-34272631 CTGGTGTTTGTAACGGACAATGG + Intergenic
1178737826 21:35168567-35168589 CTGGTTTTTGTGAGCCACAATGG - Intronic
1179155578 21:38848287-38848309 CTCGTGTCTGTGAAGAACAAGGG + Intergenic
1180540311 22:16440229-16440251 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1181319882 22:21996068-21996090 CTGGTGTTTGAGGAGAGAAATGG - Intergenic
1181912083 22:26246511-26246533 CTGGAGTTAGAGGGGAAAAATGG - Intronic
1182343829 22:29645134-29645156 CTGTCATTTGTGGGGAAAAAAGG + Intronic
1184124397 22:42476803-42476825 CTGGAGTTTTTAAAGAAAAAAGG - Intergenic
1184156796 22:42672989-42673011 CTGGTGTATGTGTGCAGAAAGGG + Intergenic
949155106 3:817336-817358 CTGGTGATTCTCAGGAAACAGGG + Intergenic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
950084016 3:10244096-10244118 CTGGTGTCTGTGAGGATTCAAGG + Intergenic
950473634 3:13202196-13202218 CTGGTGATGGTAATGAAAAATGG + Intergenic
950965642 3:17143993-17144015 CTGGGGTGTGTGAGGAAAGCTGG + Intergenic
951095672 3:18626987-18627009 CTGTTGGTTGGGAGGTAAAATGG + Intergenic
951663850 3:25100030-25100052 CAGGTGTTTTTGTGGTAAAAAGG - Intergenic
951876947 3:27437854-27437876 GTAGTTTTGGTGAGGAAAAAGGG - Intronic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
955793698 3:62613383-62613405 CAGGTGTTTATGAGGAAGAAGGG + Intronic
955895450 3:63694763-63694785 CTGGTGATACTGAGGCAAAAAGG + Intergenic
956596932 3:70977893-70977915 CTGGTGGTTGTGATGACAGAGGG + Exonic
956703429 3:71979156-71979178 CTAGTGTTTTTAAAGAAAAAAGG + Intergenic
960096098 3:113691281-113691303 CTGGTGGTTGGGAGGAAGAATGG - Intronic
962087363 3:132205814-132205836 CTGCTGTTTGGGAGGAAAGTTGG - Intronic
962759359 3:138494723-138494745 GTGGAGTTTGTGAGTAAAAGAGG - Exonic
962891006 3:139673045-139673067 CTGCTGTCTGAGAGGAAAGAAGG - Intronic
963205954 3:142634876-142634898 ATGGGGTTTGAGCGGAAAAATGG + Intronic
964120091 3:153174216-153174238 CTGTTATTTGTTAGGAAAGATGG - Intergenic
964506428 3:157405031-157405053 CTGGTGTCTGTGAGGGAAGTAGG - Intronic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
965364557 3:167782884-167782906 CTGGTGTATCTGATGCAAAACGG + Intronic
965401834 3:168221814-168221836 CTGGTATTTGTAATGAAATAGGG + Intergenic
967141599 3:186566449-186566471 CAGGTGGTTGTGAGGATGAAAGG - Intronic
967873248 3:194249514-194249536 CTGGTGTGTGGTAGGAAAAGGGG + Intergenic
968594425 4:1474906-1474928 CTGGTGTGTGTCAGGAGAGAAGG + Intergenic
971349060 4:25840390-25840412 CTTGTCTTTGTGAAAAAAAATGG - Intronic
971409681 4:26356997-26357019 GTGGGGATGGTGAGGAAAAAGGG + Intronic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972168197 4:36312698-36312720 CTTGTGTGTATGAGGAACAATGG + Intronic
972649930 4:41006772-41006794 CTAGTATTTGTAAGAAAAAAGGG + Intronic
973804436 4:54512197-54512219 TTGGTGTTCAGGAGGAAAAAAGG + Intergenic
975578751 4:75888366-75888388 CTGATATTCGTGAGGGAAAATGG + Intronic
976151030 4:82092002-82092024 CTGGGGTTGGGAAGGAAAAATGG + Intergenic
976517240 4:85982924-85982946 CTGGTGTTTGTTGGGAGAAGGGG - Intronic
976678937 4:87733735-87733757 CTGGTTTTTGGGTGGAAAACAGG - Intergenic
976764417 4:88584341-88584363 CTGATGTTTCTGAGGGTAAATGG - Intronic
976962973 4:91002365-91002387 CTGGTATTCCTGAGGAAGAAGGG - Intronic
977211835 4:94227187-94227209 CTGGTGTTTTTGAGGAAAGTGGG + Intronic
977575074 4:98666211-98666233 CTGATGTCTGTGAGGCAACATGG - Intergenic
977945773 4:102912376-102912398 CTGCTTTTGGTGAAGAAAAAAGG + Intronic
978195510 4:105967334-105967356 CAGGTGTTTGTGAGAAAACACGG + Exonic
979439795 4:120737554-120737576 CTTGTGTCTGTCAGGAAAGACGG - Intronic
980441711 4:132856426-132856448 ATGGTGGTTGTGAGGCACAAGGG + Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
982371395 4:154637362-154637384 CTTGTGGTTCTGAGGAAAGAAGG + Intronic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
982551595 4:156808129-156808151 CTGTTGTGTGAGAGGAACAAAGG + Intronic
983864279 4:172745116-172745138 CTATTGTTTGAGAGAAAAAAGGG - Intronic
984010173 4:174361144-174361166 CTGGTGAGCGTGTGGAAAAAAGG + Intergenic
984956917 4:185053956-185053978 CTGGCTTTTGTGCGGAGAAACGG + Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
986993092 5:13576595-13576617 CTGGCTTTGGTGAGGACAAAGGG + Intergenic
987459230 5:18187237-18187259 CAAGTGTTGGTGAGGAAAAAGGG - Intergenic
987591736 5:19937394-19937416 CTGATGTGTGTGAGGCACAATGG + Intronic
987994529 5:25258660-25258682 CTGGTGTTAGGGAGGGAGAAAGG + Intergenic
988237675 5:28566528-28566550 CTGGTGTGAGTGTGGAAGAAGGG + Intergenic
989403761 5:41037890-41037912 CTGGTATTTGTCAGCAAAATGGG + Intronic
989663045 5:43820394-43820416 ATGGTGGTTGTGAGGATTAAGGG + Intergenic
989981412 5:50649810-50649832 ATTGTGCTTCTGAGGAAAAAGGG - Intergenic
990132486 5:52604057-52604079 CTGTTTTTTATGAGTAAAAATGG - Intergenic
990199226 5:53352683-53352705 CTGGGGTTTCTCAGGAAAATGGG - Intergenic
990882085 5:60550103-60550125 CTGGTGATTATGTGGAGAAAAGG + Intergenic
992205726 5:74428680-74428702 GTGGTGTGTGAGGGGAAAAAAGG + Intergenic
996427345 5:123329258-123329280 TTGGTGTTCCTGAGGAAGAAGGG - Intergenic
998281980 5:140819309-140819331 CTGGGTTTTGTAAGGAATAAAGG + Intronic
999118928 5:149192754-149192776 GTGGTGTTGGTGAGTAGAAATGG - Intronic
999687655 5:154117175-154117197 CTGGGGTTTGCGAGTAAACATGG - Intronic
1000987646 5:167878266-167878288 TTGGTGTGAGTGACGAAAAATGG - Intronic
1001117960 5:168955435-168955457 CTGTTGGTGGTGAGGAAAAGAGG - Intronic
1003016734 6:2474043-2474065 CTGGGGTTTGGGAAGAGAAATGG - Intergenic
1003294169 6:4809360-4809382 CTGGTGTTTGTAATTATAAACGG + Intronic
1003774243 6:9341441-9341463 TTGCTGTCTGTGAGAAAAAAAGG + Intergenic
1004708244 6:18144684-18144706 CTGGTAATTTTGAGGAAAAGAGG + Intronic
1005403041 6:25455005-25455027 CTGGAGTTTGTTAGCAAATATGG + Intronic
1007120171 6:39373315-39373337 ATGGTGTCTGTGAGTAAATATGG + Intronic
1007162363 6:39801830-39801852 TTGGTGTCTGGGAGGAAACAAGG - Intronic
1007927878 6:45664264-45664286 CTGGTGTATTTGTGGAAAAGGGG + Intronic
1008182826 6:48354223-48354245 TTGATGTTTTTGAGGAACAATGG + Intergenic
1008233651 6:49016357-49016379 CTGGTGTTTTTATGAAAAAATGG + Intergenic
1008694558 6:54019435-54019457 CTGGTATCTCTGAGAAAAAATGG - Intronic
1008964449 6:57300254-57300276 CAGGTGCTTGTGAGGACAGAGGG - Intergenic
1009241922 6:61194792-61194814 CTGGTCCTAGAGAGGAAAAAGGG + Intergenic
1011679709 6:89771154-89771176 CTTGTGTTTGTGCAGGAAAAAGG - Intronic
1011781090 6:90790163-90790185 CCTGTGCTGGTGAGGAAAAAGGG + Intergenic
1013073510 6:106750669-106750691 CAGGTGTGTGAGAGGAAAAGAGG - Intergenic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1014096168 6:117464475-117464497 CTGGTGTATGTAAAGCAAAAAGG + Intronic
1014519229 6:122419411-122419433 CTGATGTTTGTGAGAGATAAGGG + Intronic
1014902995 6:126990682-126990704 CTGCTCTTTGTAAGGAGAAAAGG + Intergenic
1015425175 6:133056696-133056718 GTGGTGGTTGTGATGAAAATAGG + Intergenic
1015990865 6:138941403-138941425 CTGGTGGTTGCTAGGAAGAATGG - Exonic
1016176069 6:141078881-141078903 TTGGTGTTCCTGAGGAATAATGG + Intergenic
1017531709 6:155299263-155299285 CTTCTCTTTGTGAGCAAAAAGGG + Intronic
1018283702 6:162215255-162215277 CTGGTGTTGATGAATAAAAACGG + Intronic
1019738944 7:2663396-2663418 CTGGTGTCTGGGACCAAAAAGGG + Exonic
1019951159 7:4373868-4373890 CTGGTGTTTGTAAGGACAACAGG + Intergenic
1021170955 7:17397475-17397497 ATGGCATTTCTGAGGAAAAAAGG + Intergenic
1021802302 7:24319079-24319101 ATGGTGATTGTGGGGAATAAAGG - Intergenic
1022123340 7:27331626-27331648 CTGGAGTTTCTGAAGAAAGAAGG - Intergenic
1022703192 7:32780446-32780468 CTGGTGAATGTTAAGAAAAATGG + Intergenic
1022907424 7:34870580-34870602 CTGGTGAATGTTAAGAAAAATGG + Intronic
1023250642 7:38257069-38257091 CTGGTGTTTGTGGGAACAGAAGG - Intergenic
1023252184 7:38276691-38276713 CTGGTGTTTGTGGGAACAGAAGG - Intergenic
1023647252 7:42330743-42330765 CTTGTGGTTGTCAGGAAAAATGG + Intergenic
1024729755 7:52241208-52241230 ATGGTGGTTGTGAGGAACAGGGG - Intergenic
1027472387 7:78589456-78589478 CAGTTGTTTGAGAGGAAATATGG - Intronic
1028116233 7:87001139-87001161 CAGCTGATTGTGAGGAAGAAAGG + Intronic
1028739652 7:94259009-94259031 CTGGTGCCTGTGAGAAAACAAGG + Intergenic
1030408898 7:109149243-109149265 CTGGTGAGAATGAGGAAAAAGGG - Intergenic
1030526771 7:110663940-110663962 ATGGTTTTTGTGAGGATTAAAGG - Intronic
1030547461 7:110914947-110914969 TTGGTGATGGTGAGGAGAAAAGG + Intronic
1030699742 7:112624938-112624960 CTGGTGATAGGGAGGAAAATTGG + Intergenic
1031756082 7:125644552-125644574 CTGGTGTTTTAGTAGAAAAATGG + Intergenic
1033741646 7:144280598-144280620 CTCATGTTTGTGAGAAGAAAGGG - Intergenic
1033752255 7:144369016-144369038 CTCATGTTTGTGAGAAGAAAGGG + Intronic
1033851579 7:145502593-145502615 CTGGGATATGTGAGGCAAAAGGG + Intergenic
1034267244 7:149787161-149787183 TTGGTGTTAGTTAGGAAAATAGG + Intergenic
1034406515 7:150906946-150906968 TTGGTGTTGGTGTGGAGAAAAGG + Intergenic
1035914833 8:3607822-3607844 CTGGTGTTGGTGTGGCAGAAAGG + Intronic
1039367585 8:36947214-36947236 CTGGTGAGTGTGGGGAGAAAGGG + Intergenic
1040548607 8:48421306-48421328 TGTGTGTTTATGAGGAAAAACGG - Intergenic
1040706635 8:50136565-50136587 CAGGTGTTTCTCAGGACAAAAGG - Intronic
1040710496 8:50182947-50182969 ATGGTGTCTCTGAGGATAAAGGG - Intronic
1042107852 8:65348101-65348123 CTGGTGCATGTGAGGAAAAGGGG + Intergenic
1042780956 8:72490584-72490606 CTGGTGTATGCGAGAAAGAATGG - Intergenic
1042996074 8:74700518-74700540 CTTGTGTTTGTAAGGGAAATAGG - Intronic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1045370637 8:101518911-101518933 CTGCTGTTTGTGAGGCACATTGG + Intronic
1045826965 8:106409254-106409276 GTGGTGTTTGTGGGGCCAAAGGG + Intronic
1047044202 8:121033633-121033655 CTGATCCTTGTGAGGGAAAATGG + Intergenic
1050401593 9:5261953-5261975 CTGGGGTTCGTGAGGAAAACAGG + Intergenic
1050635256 9:7605610-7605632 CTTGTATCTGTGAGGAAATATGG + Intergenic
1051127332 9:13819200-13819222 CTGTTTCCTGTGAGGAAAAATGG - Intergenic
1051771947 9:20588806-20588828 CATGTGTTTGTTAGGAAAAGAGG - Intronic
1053231609 9:36415156-36415178 TTGGTGTTGTTGAGGAAGAAGGG - Intronic
1054815064 9:69466774-69466796 CTGGTGTTTGTGTGGTAACGTGG - Intronic
1055933098 9:81580015-81580037 CTGTTGTTTGTGAGGTGATAGGG - Intergenic
1056808571 9:89746724-89746746 CTGGTGTTTTGGTGGAGAAACGG - Intergenic
1056870392 9:90272214-90272236 CTAGTGTTTGTGAAGGAAAGGGG + Intergenic
1056972051 9:91213382-91213404 CAGGTGTTTGTTAGGACAAAGGG + Intergenic
1057261970 9:93589843-93589865 CTGCTGTTTGTGTGGAGAGAGGG - Intronic
1057491313 9:95522117-95522139 CTTGTGTTTGTGAGGTGGAAAGG + Intergenic
1058290634 9:103236582-103236604 CTGTTGTTTATGCGGAAACAAGG - Intergenic
1058758377 9:108104895-108104917 GTGGTGTTTGTGAGAATGAATGG + Intergenic
1059145943 9:111899321-111899343 TTAGTGTTTGTAAGGCAAAATGG - Intronic
1060961868 9:127686502-127686524 CTTGTGTATGTAAGGAAAATGGG + Intronic
1061121289 9:128644144-128644166 AGGGTGGTTGTGAGGAAGAAAGG - Intronic
1062348619 9:136127620-136127642 CAGGTGTTTGTGCTTAAAAATGG + Intergenic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1186059890 X:5693405-5693427 GTGGAGTCAGTGAGGAAAAATGG - Intergenic
1187217036 X:17287195-17287217 TTGGGGTCTGTGAGGAAAGACGG - Intergenic
1187642589 X:21311261-21311283 CTGGAATTTTTGTGGAAAAAAGG - Intergenic
1188006455 X:25019084-25019106 CTGTTGTTTATGGTGAAAAATGG + Intergenic
1188788280 X:34375926-34375948 CTGGTATTTGATAGCAAAAAAGG + Intergenic
1191668784 X:63730071-63730093 CTGGTCTCTGTGACCAAAAAAGG + Intronic
1192070643 X:67936838-67936860 CTTGTCTTTTTGATGAAAAAGGG + Intergenic
1192124272 X:68487123-68487145 CAGTTGATTGTGAGGAGAAATGG + Intergenic
1192667727 X:73105443-73105465 TTAGTGTTTCTGAAGAAAAAGGG + Intergenic
1193877981 X:86885373-86885395 CTAGTATTTGAGAGCAAAAAGGG + Intergenic
1194431932 X:93819026-93819048 CTGGTGATGATGAGGAGAAAAGG + Intergenic
1195432311 X:104803082-104803104 CTGCTGTTGGGGAGGAAGAAAGG + Intronic
1195670732 X:107467714-107467736 TTGGTGTGGGTGAGGAAAAATGG - Intergenic
1197416719 X:126184470-126184492 ATGGTGGTTGTGGGGAGAAATGG + Intergenic
1198154925 X:133949795-133949817 GTGGTTCTTGTGAAGAAAAATGG - Intronic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1198823587 X:140675186-140675208 CTGGTGAGGGTGTGGAAAAAAGG + Intergenic
1200212531 X:154353147-154353169 CTGGTGCATGTGAAGAAAAATGG - Exonic
1201181486 Y:11351816-11351838 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1201779461 Y:17703104-17703126 CTGGGGACTGTGGGGAAAAATGG - Intergenic
1201822095 Y:18202888-18202910 CTGGGGACTGTGGGGAAAAATGG + Intergenic