ID: 1067404048

View in Genome Browser
Species Human (GRCh38)
Location 10:46004254-46004276
Sequence ATGGAATGAAGCAGGATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067404048_1067404053 19 Left 1067404048 10:46004254-46004276 CCAACAATCCTGCTTCATTCCAT No data
Right 1067404053 10:46004296-46004318 ACTAGGAATAATTAAGAGCTAGG No data
1067404048_1067404051 2 Left 1067404048 10:46004254-46004276 CCAACAATCCTGCTTCATTCCAT No data
Right 1067404051 10:46004279-46004301 ATATTAACTCACACCTTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067404048 Original CRISPR ATGGAATGAAGCAGGATTGT TGG (reversed) Intergenic
No off target data available for this crispr