ID: 1067404661

View in Genome Browser
Species Human (GRCh38)
Location 10:46010714-46010736
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 2, 1: 0, 2: 1, 3: 6, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067404661_1067404671 20 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404671 10:46010757-46010779 ATCCTCTGTAACCATGCTGGGGG 0: 2
1: 1
2: 0
3: 22
4: 214
1067404661_1067404668 17 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404668 10:46010754-46010776 CCAATCCTCTGTAACCATGCTGG 0: 2
1: 0
2: 2
3: 7
4: 100
1067404661_1067404669 18 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404669 10:46010755-46010777 CAATCCTCTGTAACCATGCTGGG 0: 2
1: 0
2: 0
3: 10
4: 110
1067404661_1067404674 30 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404674 10:46010767-46010789 ACCATGCTGGGGGTGGACAATGG 0: 1
1: 2
2: 2
3: 18
4: 203
1067404661_1067404673 23 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404673 10:46010760-46010782 CTCTGTAACCATGCTGGGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 182
1067404661_1067404670 19 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404670 10:46010756-46010778 AATCCTCTGTAACCATGCTGGGG 0: 3
1: 0
2: 1
3: 15
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067404661 Original CRISPR GGACCCATGTAAGGTAGAGG AGG (reversed) Exonic
900996355 1:6125416-6125438 GGTCTCATGCCAGGTAGAGGCGG - Intronic
903945746 1:26961045-26961067 GGCCCCGAGTAGGGTAGAGGAGG + Intergenic
904352206 1:29915844-29915866 GGAGCCATGCAGGGCAGAGGCGG - Intergenic
904494451 1:30878737-30878759 GGGCCTAGGGAAGGTAGAGGTGG + Exonic
904588903 1:31596662-31596684 GGAGTCATTTAAAGTAGAGGTGG + Intergenic
904670770 1:32163306-32163328 AGACCCAGGTAAGAAAGAGGAGG + Exonic
904674418 1:32190000-32190022 GGACCCTTGTGAGGTAGCAGTGG + Intronic
905909257 1:41642555-41642577 GCACCCATACAAGGTAGAGAAGG - Intronic
910487358 1:87730252-87730274 GGACCCAGGTAATGTATTGGTGG - Intergenic
912516155 1:110217756-110217778 GCACCCATGGAGGGGAGAGGAGG + Intronic
912572136 1:110632479-110632501 GGAGCCATGTTGGGCAGAGGCGG + Intergenic
916764351 1:167845904-167845926 TGACCTATGTTAGGTAGAAGGGG - Intronic
918934856 1:190909185-190909207 GGACTGATGTAAGGTAGATGTGG + Intergenic
921963272 1:221058826-221058848 GGAGCCTTGTAGGGCAGAGGTGG + Intergenic
1065012736 10:21433999-21434021 GGACTAATGTAGGGTAGAAGAGG - Intergenic
1067404661 10:46010714-46010736 GGACCCATGTAAGGTAGAGGAGG - Exonic
1067432081 10:46251497-46251519 GGCCCCCTGTAAGGCAGAGCAGG - Intergenic
1067577803 10:47419119-47419141 GGCCCCCTGTAAGGCAGAGCAGG + Intergenic
1069682148 10:70292749-70292771 GGCCCCATCTAAGCTGGAGGAGG - Intergenic
1069920438 10:71812602-71812624 GCACCCATGTGAGCCAGAGGCGG + Exonic
1072631159 10:97147566-97147588 AGACCCAGGTGAGGCAGAGGTGG + Intronic
1076529239 10:131133586-131133608 GGCCCCATGTTTGGTAGAGAAGG - Intronic
1079538856 11:21547931-21547953 GGACACATGTAAGTAAGAGTTGG + Intronic
1084760211 11:71266116-71266138 GGACCCAAGGCAGGTGGAGGAGG - Intergenic
1085359506 11:75873804-75873826 TTACTCATGTAAGGTAGAGTTGG + Intronic
1092701141 12:11232175-11232197 GGCAACAGGTAAGGTAGAGGTGG + Intergenic
1097913470 12:64995262-64995284 GGACCCCTGTGAGGGAGAGAGGG + Intergenic
1099736449 12:86572543-86572565 GGATCCATGTGAGCTAGATGTGG - Intronic
1105974234 13:25459114-25459136 GGATCCATGGAGGGTAGAGATGG - Intronic
1106931087 13:34666302-34666324 GGAAGGATGTAAGGGAGAGGTGG - Intergenic
1114271199 14:21101338-21101360 GGAGCCATGGAAGATAGAGCTGG + Exonic
1114634116 14:24177836-24177858 GGACCCCTGTAAGCTAGCAGTGG - Intronic
1116345143 14:43784172-43784194 GAACCCCTCTAAGGGAGAGGTGG - Intergenic
1119425699 14:74533527-74533549 GGACCCTGGTAAGGAAAAGGAGG + Intronic
1121233748 14:92377489-92377511 GTACCCATGTAGGAGAGAGGTGG + Intronic
1123500207 15:20875121-20875143 GGACCCATGTCAGGTATCTGTGG + Intergenic
1123557454 15:21448815-21448837 GGACCCATGTCAGGTATCTGTGG + Intergenic
1123593680 15:21886077-21886099 GGACCCATGTCAGGTATCTGTGG + Intergenic
1129034165 15:72639737-72639759 GGACCCATGCATGGGACAGGGGG - Intergenic
1129215717 15:74097479-74097501 GGACCCATGCATGGGACAGGGGG + Intergenic
1129221479 15:74134065-74134087 GGACACAAGTGAGGGAGAGGAGG + Exonic
1129470673 15:75751749-75751771 GGACCCTGGGAAGGAAGAGGGGG + Intergenic
1129732850 15:77941807-77941829 GGACCCATGCATGGGACAGGGGG + Intergenic
1130885869 15:88092069-88092091 GCACCTATGTAAGGCAGAAGTGG - Intronic
1131360465 15:91785885-91785907 GGGCACATGTCATGTAGAGGAGG - Intergenic
1202965802 15_KI270727v1_random:175988-176010 GGACCCATGTCAGGTATCTGTGG + Intergenic
1132460801 16:53652-53674 GGACCAATGTGAGCTCGAGGCGG - Intronic
1133305419 16:4805171-4805193 GACCCCATGTGAGGAAGAGGGGG + Exonic
1133633906 16:7648301-7648323 GAACCCAGGAGAGGTAGAGGAGG - Intronic
1137572070 16:49573132-49573154 GGACTGATGGAAGGTAGAAGTGG + Intronic
1141410246 16:83828240-83828262 GGACCCATGTGAGGCAGACTCGG + Intergenic
1147121795 17:38339402-38339424 GCACCCAGGTAAGGATGAGGAGG - Exonic
1147522124 17:41183590-41183612 AGACCCATGAAATGAAGAGGAGG - Intergenic
1150089967 17:62314970-62314992 GGACCTATGCAAGGTAAAGAAGG + Intergenic
1152196353 17:78920624-78920646 GGCCCCATGGTAGGTTGAGGAGG - Intronic
1156633088 18:38994254-38994276 GGACCCAGGGAAGGTATGGGTGG - Intergenic
1161098916 19:2410659-2410681 GGAGCCATGGAGGGCAGAGGAGG - Intronic
1165754972 19:38287757-38287779 GGTCCCATGTAAAGGAGAAGTGG + Intronic
1166469252 19:43063648-43063670 GAAGCCATATAAGGTGGAGGTGG - Intronic
1166490204 19:43252726-43252748 GAAGCCATATAAGGTGGAGGTGG - Intronic
1166963898 19:46516203-46516225 AGACCCAGCCAAGGTAGAGGAGG + Intronic
1168612868 19:57814931-57814953 GTGCGCAAGTAAGGTAGAGGCGG - Intronic
926042108 2:9681589-9681611 GGGCCCATGGCAGGCAGAGGAGG - Intergenic
929047405 2:37803481-37803503 GGACCTATATATGGTAGAGGAGG - Intergenic
929805594 2:45142330-45142352 GGACCCCTGTCTGGTGGAGGAGG + Intergenic
933918716 2:87022917-87022939 GGCCCCATGTGAGGAACAGGGGG + Intergenic
933994934 2:87661229-87661251 GGACCAATGTAGGCTAGGGGAGG + Intergenic
934004279 2:87746998-87747020 GGCCCCATGTGAGGAACAGGGGG - Intergenic
940392089 2:153144040-153144062 TGACCCATGAGAGCTAGAGGTGG - Intergenic
941933563 2:170965795-170965817 GGAGGCATGGAAGGAAGAGGTGG - Exonic
946437697 2:219668931-219668953 GGGCCCATGTAAGGAAGATTTGG + Intergenic
948238544 2:236409039-236409061 GGACCCATGTCTGGGAGTGGAGG + Intronic
1170176888 20:13481103-13481125 GAACTCATGGAAGGTAGTGGAGG - Intronic
1172007195 20:31825595-31825617 AAAGCCAGGTAAGGTAGAGGGGG + Intronic
1173775681 20:45704325-45704347 GGAACCATGCAAGGCAGATGAGG + Intronic
1174790063 20:53469744-53469766 GGACCCAAGAAAGATAGAGAGGG + Intronic
1175913313 20:62414695-62414717 GGTCCCATGGCAGGTAGTGGAGG + Intronic
1177193899 21:17882120-17882142 GGCCCCATGTAAGGTACTGGTGG + Intergenic
1178718485 21:34988164-34988186 GGTGCCAGCTAAGGTAGAGGAGG + Intronic
1180048948 21:45322721-45322743 GAACCCACGTGAGGAAGAGGAGG - Intergenic
1183090502 22:35518932-35518954 GGGACCAAGCAAGGTAGAGGTGG + Intergenic
949746421 3:7298608-7298630 GGAGCCAAGGAAGGTAGATGAGG - Intronic
953788539 3:45929267-45929289 GGCCCCCTGGAAGCTAGAGGAGG + Intronic
955138869 3:56249180-56249202 GCATCCTTGTAAGGTTGAGGTGG - Intronic
961426361 3:126851638-126851660 TGACCCATGGAGGGTAGAGGCGG + Intronic
968634821 4:1672411-1672433 GGACCCAGGTGAGGTGGGGGTGG + Intronic
968891108 4:3368950-3368972 GGGGCCATGGTAGGTAGAGGCGG + Intronic
968966822 4:3773000-3773022 CAAACCATGCAAGGTAGAGGTGG + Intergenic
974882973 4:67782067-67782089 GGACCCATGTAAAGTAATGAAGG - Intergenic
981517397 4:145624814-145624836 GGACCCATGTAAGGTAGAGGAGG - Intronic
985812732 5:2101962-2101984 CATCCCATGTAAGGGAGAGGTGG - Intergenic
996467300 5:123818040-123818062 GTTTCCAAGTAAGGTAGAGGAGG - Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
998110190 5:139495457-139495479 GGACCCATGTAAGGCAGAAGAGG + Intergenic
1000796790 5:165674060-165674082 TGACCCATGTAAGGCAGGGGGGG + Intergenic
1003529769 6:6927963-6927985 GGACCCATGGAAGGACGGGGTGG + Intergenic
1008441982 6:51542195-51542217 GCACCCCTGTGAGGTAGAGTAGG + Intergenic
1008716468 6:54295523-54295545 GCACCCATGTAGGGAAGGGGAGG + Intergenic
1010288344 6:74105861-74105883 ACAGCCATGTAAGGTAGAGATGG - Intergenic
1010942399 6:81934128-81934150 GGACAGATGAAGGGTAGAGGGGG - Intergenic
1013845457 6:114445262-114445284 TGACCCCTGTAAAGTAGAGAGGG + Intergenic
1016032703 6:139354467-139354489 GGTCCCTTGTGAGGTGGAGGTGG - Intergenic
1016981915 6:149862195-149862217 AGCCTCATCTAAGGTAGAGGTGG + Intronic
1018110706 6:160534577-160534599 GGACACATGAAGGGGAGAGGGGG + Intronic
1018128062 6:160701144-160701166 GGCCCCATGTGAGGGACAGGGGG - Intergenic
1022425983 7:30269270-30269292 GGAGCCAGGGAAGGAAGAGGTGG - Intergenic
1022469621 7:30674305-30674327 GGAGCCCTGTACAGTAGAGGCGG - Intronic
1024644095 7:51356836-51356858 TGACCCCTGTAAGGTATTGGTGG + Intergenic
1026406529 7:70071825-70071847 GGAAGCATTTAAGTTAGAGGAGG + Intronic
1026912018 7:74096561-74096583 GGGCCCAGGTGAGGTGGAGGAGG + Intronic
1027223986 7:76232702-76232724 GGAGCCAAGAGAGGTAGAGGAGG + Intronic
1029884241 7:103850301-103850323 GGGCCTATGTTAGGGAGAGGAGG - Intronic
1030496891 7:110311703-110311725 GGAGCCAAGTGAGGGAGAGGAGG - Intergenic
1033987323 7:147242401-147242423 GGACACATGTAAAGAAGAAGCGG - Intronic
1046725730 8:117671629-117671651 GGACCCAGGTCAGGAAGATGTGG - Intergenic
1051565694 9:18495437-18495459 GAAACCATGTAAGGTAGAGATGG - Intronic
1053424771 9:38003673-38003695 AGAGCTATGTAAGATAGAGGAGG - Intronic
1056503820 9:87237246-87237268 AGACCCATGTAATGCAGAAGAGG - Intergenic
1061063266 9:128261410-128261432 TGACCTATCTAAGGTTGAGGGGG + Intronic
1061122873 9:128654970-128654992 TGCCCCATGTAAGCTCGAGGAGG + Intronic
1199040446 X:143109273-143109295 ACACACCTGTAAGGTAGAGGAGG - Intergenic