ID: 1067404661

View in Genome Browser
Species Human (GRCh38)
Location 10:46010714-46010736
Sequence GGACCCATGTAAGGTAGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 2, 1: 0, 2: 1, 3: 6, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067404661_1067404669 18 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404669 10:46010755-46010777 CAATCCTCTGTAACCATGCTGGG 0: 2
1: 0
2: 0
3: 10
4: 110
1067404661_1067404674 30 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404674 10:46010767-46010789 ACCATGCTGGGGGTGGACAATGG 0: 1
1: 2
2: 2
3: 18
4: 203
1067404661_1067404673 23 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404673 10:46010760-46010782 CTCTGTAACCATGCTGGGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 182
1067404661_1067404671 20 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404671 10:46010757-46010779 ATCCTCTGTAACCATGCTGGGGG 0: 2
1: 1
2: 0
3: 22
4: 214
1067404661_1067404668 17 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404668 10:46010754-46010776 CCAATCCTCTGTAACCATGCTGG 0: 2
1: 0
2: 2
3: 7
4: 100
1067404661_1067404670 19 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404670 10:46010756-46010778 AATCCTCTGTAACCATGCTGGGG 0: 3
1: 0
2: 1
3: 15
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067404661 Original CRISPR GGACCCATGTAAGGTAGAGG AGG (reversed) Exonic