ID: 1067404670

View in Genome Browser
Species Human (GRCh38)
Location 10:46010756-46010778
Sequence AATCCTCTGTAACCATGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 3, 1: 0, 2: 1, 3: 15, 4: 347}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067404662_1067404670 16 Left 1067404662 10:46010717-46010739 CCTCTACCTTACATGGGTCCTGA 0: 2
1: 1
2: 1
3: 7
4: 89
Right 1067404670 10:46010756-46010778 AATCCTCTGTAACCATGCTGGGG 0: 3
1: 0
2: 1
3: 15
4: 347
1067404666_1067404670 -2 Left 1067404666 10:46010735-46010757 CCTGATGGTTCTGGACAAGCCAA 0: 3
1: 1
2: 0
3: 5
4: 104
Right 1067404670 10:46010756-46010778 AATCCTCTGTAACCATGCTGGGG 0: 3
1: 0
2: 1
3: 15
4: 347
1067404661_1067404670 19 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404670 10:46010756-46010778 AATCCTCTGTAACCATGCTGGGG 0: 3
1: 0
2: 1
3: 15
4: 347
1067404664_1067404670 10 Left 1067404664 10:46010723-46010745 CCTTACATGGGTCCTGATGGTTC 0: 3
1: 0
2: 1
3: 5
4: 69
Right 1067404670 10:46010756-46010778 AATCCTCTGTAACCATGCTGGGG 0: 3
1: 0
2: 1
3: 15
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067404670 Original CRISPR AATCCTCTGTAACCATGCTG GGG Exonic