ID: 1067404671

View in Genome Browser
Species Human (GRCh38)
Location 10:46010757-46010779
Sequence ATCCTCTGTAACCATGCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 2, 1: 1, 2: 0, 3: 22, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067404666_1067404671 -1 Left 1067404666 10:46010735-46010757 CCTGATGGTTCTGGACAAGCCAA 0: 3
1: 1
2: 0
3: 5
4: 104
Right 1067404671 10:46010757-46010779 ATCCTCTGTAACCATGCTGGGGG 0: 2
1: 1
2: 0
3: 22
4: 214
1067404661_1067404671 20 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404671 10:46010757-46010779 ATCCTCTGTAACCATGCTGGGGG 0: 2
1: 1
2: 0
3: 22
4: 214
1067404664_1067404671 11 Left 1067404664 10:46010723-46010745 CCTTACATGGGTCCTGATGGTTC 0: 3
1: 0
2: 1
3: 5
4: 69
Right 1067404671 10:46010757-46010779 ATCCTCTGTAACCATGCTGGGGG 0: 2
1: 1
2: 0
3: 22
4: 214
1067404662_1067404671 17 Left 1067404662 10:46010717-46010739 CCTCTACCTTACATGGGTCCTGA 0: 2
1: 1
2: 1
3: 7
4: 89
Right 1067404671 10:46010757-46010779 ATCCTCTGTAACCATGCTGGGGG 0: 2
1: 1
2: 0
3: 22
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067404671 Original CRISPR ATCCTCTGTAACCATGCTGG GGG Exonic