ID: 1067404674

View in Genome Browser
Species Human (GRCh38)
Location 10:46010767-46010789
Sequence ACCATGCTGGGGGTGGACAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 2, 2: 2, 3: 18, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067404662_1067404674 27 Left 1067404662 10:46010717-46010739 CCTCTACCTTACATGGGTCCTGA 0: 2
1: 1
2: 1
3: 7
4: 89
Right 1067404674 10:46010767-46010789 ACCATGCTGGGGGTGGACAATGG 0: 1
1: 2
2: 2
3: 18
4: 203
1067404666_1067404674 9 Left 1067404666 10:46010735-46010757 CCTGATGGTTCTGGACAAGCCAA 0: 3
1: 1
2: 0
3: 5
4: 104
Right 1067404674 10:46010767-46010789 ACCATGCTGGGGGTGGACAATGG 0: 1
1: 2
2: 2
3: 18
4: 203
1067404664_1067404674 21 Left 1067404664 10:46010723-46010745 CCTTACATGGGTCCTGATGGTTC 0: 3
1: 0
2: 1
3: 5
4: 69
Right 1067404674 10:46010767-46010789 ACCATGCTGGGGGTGGACAATGG 0: 1
1: 2
2: 2
3: 18
4: 203
1067404667_1067404674 -10 Left 1067404667 10:46010754-46010776 CCAATCCTCTGTAACCATGCTGG 0: 2
1: 1
2: 2
3: 14
4: 159
Right 1067404674 10:46010767-46010789 ACCATGCTGGGGGTGGACAATGG 0: 1
1: 2
2: 2
3: 18
4: 203
1067404661_1067404674 30 Left 1067404661 10:46010714-46010736 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 1067404674 10:46010767-46010789 ACCATGCTGGGGGTGGACAATGG 0: 1
1: 2
2: 2
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067404674 Original CRISPR ACCATGCTGGGGGTGGACAA TGG Exonic