ID: 1067411446

View in Genome Browser
Species Human (GRCh38)
Location 10:46068361-46068383
Sequence GTCCCAAAGGGGGAAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067411437_1067411446 -7 Left 1067411437 10:46068345-46068367 CCCTTTCTATTCCAAAGTCCCAA No data
Right 1067411446 10:46068361-46068383 GTCCCAAAGGGGGAAGTGGGTGG No data
1067411436_1067411446 -6 Left 1067411436 10:46068344-46068366 CCCCTTTCTATTCCAAAGTCCCA No data
Right 1067411446 10:46068361-46068383 GTCCCAAAGGGGGAAGTGGGTGG No data
1067411435_1067411446 2 Left 1067411435 10:46068336-46068358 CCTAATCTCCCCTTTCTATTCCA No data
Right 1067411446 10:46068361-46068383 GTCCCAAAGGGGGAAGTGGGTGG No data
1067411438_1067411446 -8 Left 1067411438 10:46068346-46068368 CCTTTCTATTCCAAAGTCCCAAA No data
Right 1067411446 10:46068361-46068383 GTCCCAAAGGGGGAAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067411446 Original CRISPR GTCCCAAAGGGGGAAGTGGG TGG Intergenic
No off target data available for this crispr