ID: 1067412325

View in Genome Browser
Species Human (GRCh38)
Location 10:46076063-46076085
Sequence CTTGTTCTCCAGTTCTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067412322_1067412325 -10 Left 1067412322 10:46076050-46076072 CCTTGTATTTGTCCTTGTTCTCC No data
Right 1067412325 10:46076063-46076085 CTTGTTCTCCAGTTCTCTAAGGG No data
1067412317_1067412325 25 Left 1067412317 10:46076015-46076037 CCTAAGGGTCAGAAGTCTGCAGT No data
Right 1067412325 10:46076063-46076085 CTTGTTCTCCAGTTCTCTAAGGG No data
1067412321_1067412325 0 Left 1067412321 10:46076040-46076062 CCTGCTGGGGCCTTGTATTTGTC No data
Right 1067412325 10:46076063-46076085 CTTGTTCTCCAGTTCTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067412325 Original CRISPR CTTGTTCTCCAGTTCTCTAA GGG Intergenic
No off target data available for this crispr