ID: 1067412979

View in Genome Browser
Species Human (GRCh38)
Location 10:46080803-46080825
Sequence CTGGCCTAACATCTGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067412979_1067412982 -2 Left 1067412979 10:46080803-46080825 CCATCCTTCAGATGTTAGGCCAG No data
Right 1067412982 10:46080824-46080846 AGCACCTTCAACTACAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067412979 Original CRISPR CTGGCCTAACATCTGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr