ID: 1067414943

View in Genome Browser
Species Human (GRCh38)
Location 10:46095751-46095773
Sequence CTGCAGGCACACAGTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067414929_1067414943 13 Left 1067414929 10:46095715-46095737 CCTTTCCCCACCAACCCTGCCTT No data
Right 1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG No data
1067414933_1067414943 3 Left 1067414933 10:46095725-46095747 CCAACCCTGCCTTTTCCTGACAA No data
Right 1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG No data
1067414935_1067414943 -2 Left 1067414935 10:46095730-46095752 CCTGCCTTTTCCTGACAAGAGCT No data
Right 1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG No data
1067414926_1067414943 30 Left 1067414926 10:46095698-46095720 CCACGGCCACCTCAACGCCTTTC No data
Right 1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG No data
1067414932_1067414943 6 Left 1067414932 10:46095722-46095744 CCACCAACCCTGCCTTTTCCTGA No data
Right 1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG No data
1067414930_1067414943 8 Left 1067414930 10:46095720-46095742 CCCCACCAACCCTGCCTTTTCCT No data
Right 1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG No data
1067414934_1067414943 -1 Left 1067414934 10:46095729-46095751 CCCTGCCTTTTCCTGACAAGAGC No data
Right 1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG No data
1067414928_1067414943 21 Left 1067414928 10:46095707-46095729 CCTCAACGCCTTTCCCCACCAAC No data
Right 1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG No data
1067414936_1067414943 -6 Left 1067414936 10:46095734-46095756 CCTTTTCCTGACAAGAGCTGCAG No data
Right 1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG No data
1067414927_1067414943 24 Left 1067414927 10:46095704-46095726 CCACCTCAACGCCTTTCCCCACC No data
Right 1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG No data
1067414931_1067414943 7 Left 1067414931 10:46095721-46095743 CCCACCAACCCTGCCTTTTCCTG No data
Right 1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067414943 Original CRISPR CTGCAGGCACACAGTGGGGA GGG Intergenic
No off target data available for this crispr