ID: 1067419391

View in Genome Browser
Species Human (GRCh38)
Location 10:46133566-46133588
Sequence GAGACTGAGCACTGAGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067419391_1067419399 17 Left 1067419391 10:46133566-46133588 CCTAGCACTCAGTGCTCAGTCTC No data
Right 1067419399 10:46133606-46133628 CCAAAGCTGGTGCAGCTCAGTGG No data
1067419391_1067419403 25 Left 1067419391 10:46133566-46133588 CCTAGCACTCAGTGCTCAGTCTC No data
Right 1067419403 10:46133614-46133636 GGTGCAGCTCAGTGGGGCTCGGG No data
1067419391_1067419405 27 Left 1067419391 10:46133566-46133588 CCTAGCACTCAGTGCTCAGTCTC No data
Right 1067419405 10:46133616-46133638 TGCAGCTCAGTGGGGCTCGGGGG No data
1067419391_1067419393 -8 Left 1067419391 10:46133566-46133588 CCTAGCACTCAGTGCTCAGTCTC No data
Right 1067419393 10:46133581-46133603 TCAGTCTCCCAGGCTCTCTCCGG No data
1067419391_1067419401 19 Left 1067419391 10:46133566-46133588 CCTAGCACTCAGTGCTCAGTCTC No data
Right 1067419401 10:46133608-46133630 AAAGCTGGTGCAGCTCAGTGGGG No data
1067419391_1067419402 24 Left 1067419391 10:46133566-46133588 CCTAGCACTCAGTGCTCAGTCTC No data
Right 1067419402 10:46133613-46133635 TGGTGCAGCTCAGTGGGGCTCGG No data
1067419391_1067419396 4 Left 1067419391 10:46133566-46133588 CCTAGCACTCAGTGCTCAGTCTC No data
Right 1067419396 10:46133593-46133615 GCTCTCTCCGGCTCCAAAGCTGG No data
1067419391_1067419400 18 Left 1067419391 10:46133566-46133588 CCTAGCACTCAGTGCTCAGTCTC No data
Right 1067419400 10:46133607-46133629 CAAAGCTGGTGCAGCTCAGTGGG No data
1067419391_1067419404 26 Left 1067419391 10:46133566-46133588 CCTAGCACTCAGTGCTCAGTCTC No data
Right 1067419404 10:46133615-46133637 GTGCAGCTCAGTGGGGCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067419391 Original CRISPR GAGACTGAGCACTGAGTGCT AGG (reversed) Intergenic