ID: 1067425214

View in Genome Browser
Species Human (GRCh38)
Location 10:46204675-46204697
Sequence TTTCCTAGCGGGGGCCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067425214_1067425221 12 Left 1067425214 10:46204675-46204697 CCCGCAGGGCCCCCGCTAGGAAA No data
Right 1067425221 10:46204710-46204732 CCCGCCTTGAGCGCAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067425214 Original CRISPR TTTCCTAGCGGGGGCCCTGC GGG (reversed) Intergenic
No off target data available for this crispr