ID: 1067429481

View in Genome Browser
Species Human (GRCh38)
Location 10:46233730-46233752
Sequence GGGTGGGACCATGAGGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067429481_1067429488 -2 Left 1067429481 10:46233730-46233752 CCTAAGACCTCATGGTCCCACCC No data
Right 1067429488 10:46233751-46233773 CCTTTGGTGACAGATGAAGTTGG No data
1067429481_1067429491 8 Left 1067429481 10:46233730-46233752 CCTAAGACCTCATGGTCCCACCC No data
Right 1067429491 10:46233761-46233783 CAGATGAAGTTGGGGCTGTTAGG No data
1067429481_1067429493 30 Left 1067429481 10:46233730-46233752 CCTAAGACCTCATGGTCCCACCC No data
Right 1067429493 10:46233783-46233805 GAGTGGAATGAATCCATGTCTGG No data
1067429481_1067429490 0 Left 1067429481 10:46233730-46233752 CCTAAGACCTCATGGTCCCACCC No data
Right 1067429490 10:46233753-46233775 TTTGGTGACAGATGAAGTTGGGG No data
1067429481_1067429489 -1 Left 1067429481 10:46233730-46233752 CCTAAGACCTCATGGTCCCACCC No data
Right 1067429489 10:46233752-46233774 CTTTGGTGACAGATGAAGTTGGG No data
1067429481_1067429492 13 Left 1067429481 10:46233730-46233752 CCTAAGACCTCATGGTCCCACCC No data
Right 1067429492 10:46233766-46233788 GAAGTTGGGGCTGTTAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067429481 Original CRISPR GGGTGGGACCATGAGGTCTT AGG (reversed) Intergenic
No off target data available for this crispr