ID: 1067429484

View in Genome Browser
Species Human (GRCh38)
Location 10:46233746-46233768
Sequence TTCATCTGTCACCAAAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067429484_1067429494 25 Left 1067429484 10:46233746-46233768 CCCACCCTTTGGTGACAGATGAA No data
Right 1067429494 10:46233794-46233816 ATCCATGTCTGGCATCCCCATGG No data
1067429484_1067429493 14 Left 1067429484 10:46233746-46233768 CCCACCCTTTGGTGACAGATGAA No data
Right 1067429493 10:46233783-46233805 GAGTGGAATGAATCCATGTCTGG No data
1067429484_1067429491 -8 Left 1067429484 10:46233746-46233768 CCCACCCTTTGGTGACAGATGAA No data
Right 1067429491 10:46233761-46233783 CAGATGAAGTTGGGGCTGTTAGG No data
1067429484_1067429492 -3 Left 1067429484 10:46233746-46233768 CCCACCCTTTGGTGACAGATGAA No data
Right 1067429492 10:46233766-46233788 GAAGTTGGGGCTGTTAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067429484 Original CRISPR TTCATCTGTCACCAAAGGGT GGG (reversed) Intergenic
No off target data available for this crispr