ID: 1067429485

View in Genome Browser
Species Human (GRCh38)
Location 10:46233747-46233769
Sequence CTTCATCTGTCACCAAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067429485_1067429492 -4 Left 1067429485 10:46233747-46233769 CCACCCTTTGGTGACAGATGAAG No data
Right 1067429492 10:46233766-46233788 GAAGTTGGGGCTGTTAGGAGTGG No data
1067429485_1067429493 13 Left 1067429485 10:46233747-46233769 CCACCCTTTGGTGACAGATGAAG No data
Right 1067429493 10:46233783-46233805 GAGTGGAATGAATCCATGTCTGG No data
1067429485_1067429494 24 Left 1067429485 10:46233747-46233769 CCACCCTTTGGTGACAGATGAAG No data
Right 1067429494 10:46233794-46233816 ATCCATGTCTGGCATCCCCATGG No data
1067429485_1067429491 -9 Left 1067429485 10:46233747-46233769 CCACCCTTTGGTGACAGATGAAG No data
Right 1067429491 10:46233761-46233783 CAGATGAAGTTGGGGCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067429485 Original CRISPR CTTCATCTGTCACCAAAGGG TGG (reversed) Intergenic
No off target data available for this crispr