ID: 1067429486

View in Genome Browser
Species Human (GRCh38)
Location 10:46233750-46233772
Sequence CAACTTCATCTGTCACCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067429486_1067429494 21 Left 1067429486 10:46233750-46233772 CCCTTTGGTGACAGATGAAGTTG No data
Right 1067429494 10:46233794-46233816 ATCCATGTCTGGCATCCCCATGG No data
1067429486_1067429492 -7 Left 1067429486 10:46233750-46233772 CCCTTTGGTGACAGATGAAGTTG No data
Right 1067429492 10:46233766-46233788 GAAGTTGGGGCTGTTAGGAGTGG No data
1067429486_1067429497 29 Left 1067429486 10:46233750-46233772 CCCTTTGGTGACAGATGAAGTTG No data
Right 1067429497 10:46233802-46233824 CTGGCATCCCCATGGCACCAGGG No data
1067429486_1067429496 28 Left 1067429486 10:46233750-46233772 CCCTTTGGTGACAGATGAAGTTG No data
Right 1067429496 10:46233801-46233823 TCTGGCATCCCCATGGCACCAGG No data
1067429486_1067429493 10 Left 1067429486 10:46233750-46233772 CCCTTTGGTGACAGATGAAGTTG No data
Right 1067429493 10:46233783-46233805 GAGTGGAATGAATCCATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067429486 Original CRISPR CAACTTCATCTGTCACCAAA GGG (reversed) Intergenic
No off target data available for this crispr