ID: 1067429487

View in Genome Browser
Species Human (GRCh38)
Location 10:46233751-46233773
Sequence CCAACTTCATCTGTCACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067429487_1067429496 27 Left 1067429487 10:46233751-46233773 CCTTTGGTGACAGATGAAGTTGG No data
Right 1067429496 10:46233801-46233823 TCTGGCATCCCCATGGCACCAGG No data
1067429487_1067429493 9 Left 1067429487 10:46233751-46233773 CCTTTGGTGACAGATGAAGTTGG No data
Right 1067429493 10:46233783-46233805 GAGTGGAATGAATCCATGTCTGG No data
1067429487_1067429494 20 Left 1067429487 10:46233751-46233773 CCTTTGGTGACAGATGAAGTTGG No data
Right 1067429494 10:46233794-46233816 ATCCATGTCTGGCATCCCCATGG No data
1067429487_1067429497 28 Left 1067429487 10:46233751-46233773 CCTTTGGTGACAGATGAAGTTGG No data
Right 1067429497 10:46233802-46233824 CTGGCATCCCCATGGCACCAGGG No data
1067429487_1067429492 -8 Left 1067429487 10:46233751-46233773 CCTTTGGTGACAGATGAAGTTGG No data
Right 1067429492 10:46233766-46233788 GAAGTTGGGGCTGTTAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067429487 Original CRISPR CCAACTTCATCTGTCACCAA AGG (reversed) Intergenic