ID: 1067429488

View in Genome Browser
Species Human (GRCh38)
Location 10:46233751-46233773
Sequence CCTTTGGTGACAGATGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067429481_1067429488 -2 Left 1067429481 10:46233730-46233752 CCTAAGACCTCATGGTCCCACCC No data
Right 1067429488 10:46233751-46233773 CCTTTGGTGACAGATGAAGTTGG No data
1067429483_1067429488 -9 Left 1067429483 10:46233737-46233759 CCTCATGGTCCCACCCTTTGGTG No data
Right 1067429488 10:46233751-46233773 CCTTTGGTGACAGATGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067429488 Original CRISPR CCTTTGGTGACAGATGAAGT TGG Intergenic
No off target data available for this crispr