ID: 1067429488 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:46233751-46233773 |
Sequence | CCTTTGGTGACAGATGAAGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1067429481_1067429488 | -2 | Left | 1067429481 | 10:46233730-46233752 | CCTAAGACCTCATGGTCCCACCC | No data | ||
Right | 1067429488 | 10:46233751-46233773 | CCTTTGGTGACAGATGAAGTTGG | No data | ||||
1067429483_1067429488 | -9 | Left | 1067429483 | 10:46233737-46233759 | CCTCATGGTCCCACCCTTTGGTG | No data | ||
Right | 1067429488 | 10:46233751-46233773 | CCTTTGGTGACAGATGAAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1067429488 | Original CRISPR | CCTTTGGTGACAGATGAAGT TGG | Intergenic | ||