ID: 1067429492

View in Genome Browser
Species Human (GRCh38)
Location 10:46233766-46233788
Sequence GAAGTTGGGGCTGTTAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067429485_1067429492 -4 Left 1067429485 10:46233747-46233769 CCACCCTTTGGTGACAGATGAAG No data
Right 1067429492 10:46233766-46233788 GAAGTTGGGGCTGTTAGGAGTGG No data
1067429486_1067429492 -7 Left 1067429486 10:46233750-46233772 CCCTTTGGTGACAGATGAAGTTG No data
Right 1067429492 10:46233766-46233788 GAAGTTGGGGCTGTTAGGAGTGG No data
1067429484_1067429492 -3 Left 1067429484 10:46233746-46233768 CCCACCCTTTGGTGACAGATGAA No data
Right 1067429492 10:46233766-46233788 GAAGTTGGGGCTGTTAGGAGTGG No data
1067429487_1067429492 -8 Left 1067429487 10:46233751-46233773 CCTTTGGTGACAGATGAAGTTGG No data
Right 1067429492 10:46233766-46233788 GAAGTTGGGGCTGTTAGGAGTGG No data
1067429481_1067429492 13 Left 1067429481 10:46233730-46233752 CCTAAGACCTCATGGTCCCACCC No data
Right 1067429492 10:46233766-46233788 GAAGTTGGGGCTGTTAGGAGTGG No data
1067429483_1067429492 6 Left 1067429483 10:46233737-46233759 CCTCATGGTCCCACCCTTTGGTG No data
Right 1067429492 10:46233766-46233788 GAAGTTGGGGCTGTTAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067429492 Original CRISPR GAAGTTGGGGCTGTTAGGAG TGG Intergenic
No off target data available for this crispr