ID: 1067429496

View in Genome Browser
Species Human (GRCh38)
Location 10:46233801-46233823
Sequence TCTGGCATCCCCATGGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067429486_1067429496 28 Left 1067429486 10:46233750-46233772 CCCTTTGGTGACAGATGAAGTTG No data
Right 1067429496 10:46233801-46233823 TCTGGCATCCCCATGGCACCAGG No data
1067429487_1067429496 27 Left 1067429487 10:46233751-46233773 CCTTTGGTGACAGATGAAGTTGG No data
Right 1067429496 10:46233801-46233823 TCTGGCATCCCCATGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067429496 Original CRISPR TCTGGCATCCCCATGGCACC AGG Intergenic