ID: 1067429497

View in Genome Browser
Species Human (GRCh38)
Location 10:46233802-46233824
Sequence CTGGCATCCCCATGGCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067429487_1067429497 28 Left 1067429487 10:46233751-46233773 CCTTTGGTGACAGATGAAGTTGG No data
Right 1067429497 10:46233802-46233824 CTGGCATCCCCATGGCACCAGGG No data
1067429486_1067429497 29 Left 1067429486 10:46233750-46233772 CCCTTTGGTGACAGATGAAGTTG No data
Right 1067429497 10:46233802-46233824 CTGGCATCCCCATGGCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067429497 Original CRISPR CTGGCATCCCCATGGCACCA GGG Intergenic
No off target data available for this crispr