ID: 1067431120

View in Genome Browser
Species Human (GRCh38)
Location 10:46246771-46246793
Sequence CTCTTCACTGCAGAGTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067431120_1067431122 5 Left 1067431120 10:46246771-46246793 CCTCTTCACTCTGCAGTGAAGAG No data
Right 1067431122 10:46246799-46246821 CAGCCTATGCCTGTCCTGGCAGG 0: 2
1: 0
2: 2
3: 18
4: 217
1067431120_1067431121 1 Left 1067431120 10:46246771-46246793 CCTCTTCACTCTGCAGTGAAGAG No data
Right 1067431121 10:46246795-46246817 CAGACAGCCTATGCCTGTCCTGG 0: 2
1: 0
2: 1
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067431120 Original CRISPR CTCTTCACTGCAGAGTGAAG AGG (reversed) Intergenic
No off target data available for this crispr