ID: 1067433393

View in Genome Browser
Species Human (GRCh38)
Location 10:46260466-46260488
Sequence CCTGATTTGCAGTTTGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067433393_1067433396 27 Left 1067433393 10:46260466-46260488 CCAGAGACAAACTGCAAATCAGG No data
Right 1067433396 10:46260516-46260538 GACAGCTTTTTTCAAGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067433393 Original CRISPR CCTGATTTGCAGTTTGTCTC TGG (reversed) Intergenic
No off target data available for this crispr