ID: 1067434022

View in Genome Browser
Species Human (GRCh38)
Location 10:46264793-46264815
Sequence CCTTGAAGTGAGGCAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067434022_1067434030 7 Left 1067434022 10:46264793-46264815 CCCAGGCCTGCCTCACTTCAAGG No data
Right 1067434030 10:46264823-46264845 CACTGACTGCTGACATCAGCCGG No data
1067434022_1067434032 12 Left 1067434022 10:46264793-46264815 CCCAGGCCTGCCTCACTTCAAGG No data
Right 1067434032 10:46264828-46264850 ACTGCTGACATCAGCCGGCTGGG No data
1067434022_1067434031 11 Left 1067434022 10:46264793-46264815 CCCAGGCCTGCCTCACTTCAAGG No data
Right 1067434031 10:46264827-46264849 GACTGCTGACATCAGCCGGCTGG No data
1067434022_1067434033 17 Left 1067434022 10:46264793-46264815 CCCAGGCCTGCCTCACTTCAAGG No data
Right 1067434033 10:46264833-46264855 TGACATCAGCCGGCTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067434022 Original CRISPR CCTTGAAGTGAGGCAGGCCT GGG (reversed) Intergenic
No off target data available for this crispr